EMAIL THIS PAGE TO A FRIEND

OR5AN1

olfactory receptor, family 5, subfamily AN, member 1

14 Gene Product Result for
Synonyms: OR11-244
Species: Human OR5AN1(390195)
UniProtKB ID: Q8NGI8, B9EIS2, Q6IEV4
Gene ID:
Human(390195) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301894 ANTI-OR5AN1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372411 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004729 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033120 predicted 475
2 SASI_Hs01_00033121 predicted 393
3 SASI_Hs01_00033122 predicted 289
4 SASI_Hs01_00033123 predicted 632
5 SASI_Hs01_00033124 predicted 594
6 SASI_Hs01_00033125 predicted 362
7 SASI_Hs01_00033126 predicted 337
8 SASI_Hs01_00033127 predicted 358
9 SASI_Hs01_00033128 predicted 546
10 SASI_Hs02_00304687 predicted 648
11 SASI_Hs01_00033119 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372411
OR5AN1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily AN, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000193136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-750s1c2
Sequence:CCGGCCTCTTCTATACATCAGGAATCTCGAGATTCCTGATGTATAGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-177s1c1
Sequence:CCGGCATGTATTTCTTCCTCAGTAACTCGAGTTACTGAGGAAGAAATACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-189s1c1
Sequence:CCGGCCTCAGTAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372411
OR5AN1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily AN, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000193136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-750s1c2
Sequence:CCGGCCTCTTCTATACATCAGGAATCTCGAGATTCCTGATGTATAGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-177s1c1
Sequence:CCGGCATGTATTTCTTCCTCAGTAACTCGAGTTACTGAGGAAGAAATACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-189s1c1
Sequence:CCGGCCTCAGTAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372411
OR5AN1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily AN, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000193136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-750s1c2
Sequence:CCGGCCTCTTCTATACATCAGGAATCTCGAGATTCCTGATGTATAGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-177s1c1
Sequence:CCGGCATGTATTTCTTCCTCAGTAACTCGAGTTACTGAGGAAGAAATACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372411.1-189s1c1
Sequence:CCGGCCTCAGTAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)