EMAIL THIS PAGE TO A FRIEND

OR5AP2

olfactory receptor, family 5, subfamily AP, member 2

16 Gene Product Result for
Synonyms: OR9J1
Species: Human OR5AP2(338675)
UniProtKB ID: Q8NGF4, B2RNM8
Gene ID:
Human(338675) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501492 Anti-OR5AP2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002925 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057717 predicted 481
2 SASI_Hs01_00057718 predicted 375
3 SASI_Hs01_00057720 predicted 264
4 SASI_Hs02_00304279 predicted 690
5 SASI_Hs01_00057723 predicted 298
6 SASI_Hs02_00304280 predicted 601
7 SASI_Hs01_00057724 predicted 480
8 SASI_Hs01_00057725 predicted 525
9 SASI_Hs02_00304281 predicted 595
10 SASI_Hs01_00057726 predicted 374
11 SASI_Hs01_00057719 predicted 413
12 SASI_Hs01_00057721 predicted 236
13 SASI_Hs01_00057722 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291862
OR5AP2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily AP, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-310s1c1
Sequence:CCGGGCTGCCCAGTTCTACTTCTTTCTCGAGAAAGAAGTAGAACTGGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-660s1c1
Sequence:CCGGCCTCATTTCCTACCTGTGTATCTCGAGATACACAGGTAGGAAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-103s1c1
Sequence:CCGGGCATTGTTTCTGTTGATCTATCTCGAGATAGATCAACAGAAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-644s1c1
Sequence:CCGGGCTGTGTTATGATTGTCCTCACTCGAGTGAGGACAATCATAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-594s1c1
Sequence:CCGGCCACTTCAATGGCATTGTGATCTCGAGATCACAATGCCATTGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-191s1c1
Sequence:CCGGCCATGTATTTCTTTCTCAGTACTCGAGTACTGAGAAAGAAATACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291862
OR5AP2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily AP, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-310s1c1
Sequence:CCGGGCTGCCCAGTTCTACTTCTTTCTCGAGAAAGAAGTAGAACTGGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-660s1c1
Sequence:CCGGCCTCATTTCCTACCTGTGTATCTCGAGATACACAGGTAGGAAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-103s1c1
Sequence:CCGGGCATTGTTTCTGTTGATCTATCTCGAGATAGATCAACAGAAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-644s1c1
Sequence:CCGGGCTGTGTTATGATTGTCCTCACTCGAGTGAGGACAATCATAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-594s1c1
Sequence:CCGGCCACTTCAATGGCATTGTGATCTCGAGATCACAATGCCATTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-191s1c1
Sequence:CCGGCCATGTATTTCTTTCTCAGTACTCGAGTACTGAGAAAGAAATACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291862
OR5AP2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily AP, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-310s1c1
Sequence:CCGGGCTGCCCAGTTCTACTTCTTTCTCGAGAAAGAAGTAGAACTGGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-660s1c1
Sequence:CCGGCCTCATTTCCTACCTGTGTATCTCGAGATACACAGGTAGGAAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-103s1c1
Sequence:CCGGGCATTGTTTCTGTTGATCTATCTCGAGATAGATCAACAGAAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-644s1c1
Sequence:CCGGGCTGTGTTATGATTGTCCTCACTCGAGTGAGGACAATCATAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-594s1c1
Sequence:CCGGCCACTTCAATGGCATTGTGATCTCGAGATCACAATGCCATTGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291862.3-191s1c1
Sequence:CCGGCCATGTATTTCTTTCTCAGTACTCGAGTACTGAGAAAGAAATACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)