EMAIL THIS PAGE TO A FRIEND

OR5AS1

olfactory receptor, family 5, subfamily AS, member 1

14 Gene Product Result for
Synonyms: OR11-168
UniProtKB ID: Q8N127, Q6IFB8
Gene ID:
Human(219447) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
chicken(428825) olfactory receptor, family 5, subfamily AS, member 1
cow(787386) olfactory receptor, family 5, subfamily AS, member 1
dog(100685814) olfactory receptor, family 5, subfamily AS, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166808 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017134 predicted 283
2 SASI_Hs01_00017135 predicted 478
3 SASI_Hs01_00017136 predicted 327
4 SASI_Hs01_00017137 predicted 239
5 SASI_Hs01_00017138 predicted 724
6 SASI_Hs01_00017139 predicted 719
7 SASI_Hs01_00017140 predicted 721
8 SASI_Hs01_00017141 predicted 563
9 SASI_Hs01_00017142 predicted 272
10 SASI_Hs01_00017143 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166808
OR5AS1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily AS, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-760s1c1
Sequence:CCGGGCGCTCCTGTTTATGTACTTACTCGAGTAAGTACATAAACAGGAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-762s1c1
Sequence:CCGGGCTCCTGTTTATGTACTTACACTCGAGTGTAAGTACATAAACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-962s1c1
Sequence:CCGGCCTTGTTGTATACAGTCATTACTCGAGTAATGACTGTATACAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166808
OR5AS1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily AS, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-760s1c1
Sequence:CCGGGCGCTCCTGTTTATGTACTTACTCGAGTAAGTACATAAACAGGAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-762s1c1
Sequence:CCGGGCTCCTGTTTATGTACTTACACTCGAGTGTAAGTACATAAACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-962s1c1
Sequence:CCGGCCTTGTTGTATACAGTCATTACTCGAGTAATGACTGTATACAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166808
OR5AS1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily AS, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-760s1c1
Sequence:CCGGGCGCTCCTGTTTATGTACTTACTCGAGTAAGTACATAAACAGGAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-762s1c1
Sequence:CCGGGCTCCTGTTTATGTACTTACACTCGAGTGTAAGTACATAAACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166808.3-962s1c1
Sequence:CCGGCCTTGTTGTATACAGTCATTACTCGAGTAATGACTGTATACAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)