EMAIL THIS PAGE TO A FRIEND

OR5C1

olfactory receptor, family 5, subfamily C, member 1

14 Gene Product Result for
Synonyms: OR5C2P OR9-31 OR9-F
UniProtKB ID: Q8NGR4, B2RN54, B9EGT0, Q96RC4
Gene ID:
Human(392391) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(609809) olfactory receptor, family 5, subfamily C, member 1
cow(507721) olfactory receptor, family 5, subfamily C, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373316 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136521 MISSION® esiRNA esiRNA human OR5C1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001923 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211086 predicted 326
2 SASI_Hs01_00211087 predicted 462
3 SASI_Hs01_00211088 predicted 635
4 SASI_Hs01_00211089 predicted 395
5 SASI_Hs01_00211090 predicted 469
6 SASI_Hs01_00211091 predicted 313
7 SASI_Hs01_00211092 predicted 573
8 SASI_Hs01_00211093 predicted 577
9 SASI_Hs01_00211094 predicted 405
10 SASI_Hs02_00303997 predicted 572
11 SASI_Hs01_00211095 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373316
OR5C1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily C, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-398s1c1
Sequence:CCGGCACTTCTCTATACAACAGCTACTCGAGTAGCTGTTGTATAGAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-759s1c1
Sequence:CCGGCATGATGTACGGGACACTCATCTCGAGATGAGTGTCCCGTACATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-525s1c1
Sequence:CCGGCCGGAAGATCAATAGCTTCTTCTCGAGAAGAAGCTATTGATCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-329s1c1
Sequence:CCGGGTCTGGCTGATACTGAGTGTTCTCGAGAACACTCAGTATCAGCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-654s1c1
Sequence:CCGGCACGGTGTCTTATGGCTTCATCTCGAGATGAAGCCATAAGACACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373316
OR5C1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily C, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-398s1c1
Sequence:CCGGCACTTCTCTATACAACAGCTACTCGAGTAGCTGTTGTATAGAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-759s1c1
Sequence:CCGGCATGATGTACGGGACACTCATCTCGAGATGAGTGTCCCGTACATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-525s1c1
Sequence:CCGGCCGGAAGATCAATAGCTTCTTCTCGAGAAGAAGCTATTGATCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-329s1c1
Sequence:CCGGGTCTGGCTGATACTGAGTGTTCTCGAGAACACTCAGTATCAGCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-654s1c1
Sequence:CCGGCACGGTGTCTTATGGCTTCATCTCGAGATGAAGCCATAAGACACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373316
OR5C1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily C, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-398s1c1
Sequence:CCGGCACTTCTCTATACAACAGCTACTCGAGTAGCTGTTGTATAGAGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-759s1c1
Sequence:CCGGCATGATGTACGGGACACTCATCTCGAGATGAGTGTCCCGTACATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-525s1c1
Sequence:CCGGCCGGAAGATCAATAGCTTCTTCTCGAGAAGAAGCTATTGATCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-329s1c1
Sequence:CCGGGTCTGGCTGATACTGAGTGTTCTCGAGAACACTCAGTATCAGCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373316.1-654s1c1
Sequence:CCGGCACGGTGTCTTATGGCTTCATCTCGAGATGAAGCCATAAGACACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)