EMAIL THIS PAGE TO A FRIEND

OR5D13

olfactory receptor, family 5, subfamily D, member 13

17 Gene Product Result for
UniProtKB ID: Q8NGL4, Q6IF68, Q6IFC9
Gene ID:
Human(390142) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(789281) olfactory receptor, family 5, subfamily D, member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001967 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304044 predicted 625
2 SASI_Hs02_00304045 predicted 399
3 SASI_Hs01_00106617 predicted 630
4 SASI_Hs02_00304046 predicted 383
5 SASI_Hs01_00106618 predicted 645
6 SASI_Hs01_00106619 predicted 387
7 SASI_Hs01_00106620 predicted 453
8 SASI_Hs01_00106621 predicted 234
9 SASI_Hs01_00106622 predicted 538
10 SASI_Hs01_00106623 predicted 505
11 SASI_Hs01_00106616 predicted 332
12 SASI_Hs01_00106624 predicted 621
13 SASI_Hs01_00106625 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372386
OR5D13 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily D, member 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-587s1c1
Sequence:CCGGGCCAGAGGCTATGCTTTATTACTCGAGTAATAAAGCATAGCCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-276s1c1
Sequence:CCGGCATCTCTTTCTCTGGTTGCATCTCGAGATGCAACCAGAGAAAGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-632s1c1
Sequence:CCGGGCCTAATTATCATTCTGACATCTCGAGATGTCAGAATGATAATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-594s1c1
Sequence:CCGGGCTATGCTTTATTATTGCCATCTCGAGATGGCAATAATAAAGCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-467s1c1
Sequence:CCGGGCTCCCTGATACTCACATATTCTCGAGAATATGTGAGTATCAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372386
OR5D13 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily D, member 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-587s1c1
Sequence:CCGGGCCAGAGGCTATGCTTTATTACTCGAGTAATAAAGCATAGCCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-276s1c1
Sequence:CCGGCATCTCTTTCTCTGGTTGCATCTCGAGATGCAACCAGAGAAAGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-632s1c1
Sequence:CCGGGCCTAATTATCATTCTGACATCTCGAGATGTCAGAATGATAATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-594s1c1
Sequence:CCGGGCTATGCTTTATTATTGCCATCTCGAGATGGCAATAATAAAGCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-467s1c1
Sequence:CCGGGCTCCCTGATACTCACATATTCTCGAGAATATGTGAGTATCAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372386
OR5D13 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily D, member 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-587s1c1
Sequence:CCGGGCCAGAGGCTATGCTTTATTACTCGAGTAATAAAGCATAGCCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-276s1c1
Sequence:CCGGCATCTCTTTCTCTGGTTGCATCTCGAGATGCAACCAGAGAAAGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-632s1c1
Sequence:CCGGGCCTAATTATCATTCTGACATCTCGAGATGTCAGAATGATAATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-594s1c1
Sequence:CCGGGCTATGCTTTATTATTGCCATCTCGAGATGGCAATAATAAAGCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372386.1-467s1c1
Sequence:CCGGGCTCCCTGATACTCACATATTCTCGAGAATATGTGAGTATCAGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)