EMAIL THIS PAGE TO A FRIEND

OR5H14

olfactory receptor, family 5, subfamily H, member 14

8 Gene Product Result for
Species: Human OR5H14(403273)
UniProtKB ID: A6NHG9, B9EH15
Gene ID:
Human(403273) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301859 ANTI-OR5H14 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005514 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005514 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221238 predicted 652
2 SASI_Hs01_00221239 predicted 659
3 SASI_Hs01_00221240 predicted 205
4 SASI_Hs02_00304978 predicted 546
5 SASI_Hs01_00221241 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005514
OR5H14 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily H, member 14
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000194236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-156s1c2
Sequence:CCGGCCCTCATCTTCATATCCCAATCTCGAGATTGGGATATGAAGATGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-466s1c1
Sequence:CCGGGCTTTAATCCATGAAGGATTTCTCGAGAAATCCTTCATGGATTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-313s1c1
Sequence:CCGGGCAATCAGTGTAACCACGGAACTCGAGTTCCGTGGTTACACTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005514
OR5H14 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily H, member 14
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000194236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-156s1c2
Sequence:CCGGCCCTCATCTTCATATCCCAATCTCGAGATTGGGATATGAAGATGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-466s1c1
Sequence:CCGGGCTTTAATCCATGAAGGATTTCTCGAGAAATCCTTCATGGATTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-313s1c1
Sequence:CCGGGCAATCAGTGTAACCACGGAACTCGAGTTCCGTGGTTACACTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005514
OR5H14 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily H, member 14
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000194236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-156s1c2
Sequence:CCGGCCCTCATCTTCATATCCCAATCTCGAGATTGGGATATGAAGATGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-466s1c1
Sequence:CCGGGCTTTAATCCATGAAGGATTTCTCGAGAAATCCTTCATGGATTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005514.1-313s1c1
Sequence:CCGGGCAATCAGTGTAACCACGGAACTCGAGTTCCGTGGTTACACTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)