EMAIL THIS PAGE TO A FRIEND

OR5H15

olfactory receptor, family 5, subfamily H, member 15

5 Gene Product Result for
Species: Human OR5H15(403274)
UniProtKB ID: A6NDH6
Gene ID:
Human(403274) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501781 Anti-OR5H15 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005515 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005515 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048981 predicted 661
2 SASI_Hs01_00048980 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005515
OR5H15 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily H, member 15
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-252s1c1
Sequence:CCGGCTTCTTAGCTAAGAGTAAGATCTCGAGATCTTACTCTTAGCTAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-162s1c1
Sequence:CCGGCCTTCATATCCCAATGTACTTCTCGAGAAGTACATTGGGATATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-622s1c1
Sequence:CCGGGTATTCAGCATTGTGACTATTCTCGAGAATAGTCACAATGCTGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-451s1c1
Sequence:CCGGGCTGGTATTCTTCATGCTTTACTCGAGTAAAGCATGAAGAATACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005515
OR5H15 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily H, member 15
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-252s1c1
Sequence:CCGGCTTCTTAGCTAAGAGTAAGATCTCGAGATCTTACTCTTAGCTAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-162s1c1
Sequence:CCGGCCTTCATATCCCAATGTACTTCTCGAGAAGTACATTGGGATATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-622s1c1
Sequence:CCGGGTATTCAGCATTGTGACTATTCTCGAGAATAGTCACAATGCTGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-451s1c1
Sequence:CCGGGCTGGTATTCTTCATGCTTTACTCGAGTAAAGCATGAAGAATACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005515
OR5H15 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily H, member 15
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-252s1c1
Sequence:CCGGCTTCTTAGCTAAGAGTAAGATCTCGAGATCTTACTCTTAGCTAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-162s1c1
Sequence:CCGGCCTTCATATCCCAATGTACTTCTCGAGAAGTACATTGGGATATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-622s1c1
Sequence:CCGGGTATTCAGCATTGTGACTATTCTCGAGAATAGTCACAATGCTGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005515.1-451s1c1
Sequence:CCGGGCTGGTATTCTTCATGCTTTACTCGAGTAAAGCATGAAGAATACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)