EMAIL THIS PAGE TO A FRIEND

OR5H2

olfactory receptor, family 5, subfamily H, member 2

13 Gene Product Result for
Synonyms: OR3-10
UniProtKB ID: Q8NGV7, Q6IF87
Gene ID:
Human(79310) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(487943) olfactory receptor, family 5, subfamily H, member 2
cow(783995) olfactory receptor, family 5, subfamily H, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302331 ANTI-OR5H2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005482 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005482 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035435 predicted 579
2 SASI_Hs01_00035436 predicted 494
3 SASI_Hs01_00035437 predicted 552
4 SASI_Hs01_00035438 predicted 635
5 SASI_Hs01_00035439 predicted 575
6 SASI_Hs01_00035440 predicted 641
7 SASI_Hs01_00035441 predicted 394
8 SASI_Hs01_00035442 predicted 545
9 SASI_Hs01_00035443 predicted 521
10 SASI_Hs01_00035444 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005482
OR5H2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily H, member 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000202740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-400s1c1
Sequence:CCGGCCTTTACTATATCCAGTGATTCTCGAGAATCACTGGATATAGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-112s1c1
Sequence:CCGGGTGATCTATCTCATCACTATTCTCGAGAATAGTGATGAGATAGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-481s1c1
Sequence:CCGGGCCTTAATTCATGAAGTCCTTCTCGAGAAGGACTTCATGAATTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005482
OR5H2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily H, member 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000202740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-400s1c1
Sequence:CCGGCCTTTACTATATCCAGTGATTCTCGAGAATCACTGGATATAGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-112s1c1
Sequence:CCGGGTGATCTATCTCATCACTATTCTCGAGAATAGTGATGAGATAGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-481s1c1
Sequence:CCGGGCCTTAATTCATGAAGTCCTTCTCGAGAAGGACTTCATGAATTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005482
OR5H2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily H, member 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000202740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-400s1c1
Sequence:CCGGCCTTTACTATATCCAGTGATTCTCGAGAATCACTGGATATAGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-112s1c1
Sequence:CCGGGTGATCTATCTCATCACTATTCTCGAGAATAGTGATGAGATAGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005482.1-481s1c1
Sequence:CCGGGCCTTAATTCATGAAGTCCTTCTCGAGAAGGACTTCATGAATTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)