EMAIL THIS PAGE TO A FRIEND

OR5K4

olfactory receptor, family 5, subfamily K, member 4

13 Gene Product Result for
UniProtKB ID: A6NMS3
Gene ID:
Human(403278) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(100300844) olfactory receptor, family 5, subfamily K, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005517 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005517 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118576 predicted 638
2 SASI_Hs01_00118577 predicted 623
3 SASI_Hs01_00118578 predicted 535
4 SASI_Hs01_00118580 predicted 630
5 SASI_Hs01_00118581 predicted 553
6 SASI_Hs01_00118582 predicted 573
7 SASI_Hs01_00118583 predicted 566
8 SASI_Hs01_00118584 predicted 568
9 SASI_Hs01_00118585 predicted 557
10 SASI_Hs02_00304981 predicted 32
11 SASI_Hs01_00118579 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005517
OR5K4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily K, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-729s1c1
Sequence:CCGGCCACTTTCTCTCTGTCTCAATCTCGAGATTGAGACAGAGAGAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-282s1c1
Sequence:CCGGGTATGAATGTATGGCACAATTCTCGAGAATTGTGCCATACATTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-536s1c1
Sequence:CCGGGTGATATTCTTCCACTGTATACTCGAGTATACAGTGGAAGAATATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-81s1c1
Sequence:CCGGGTTTGTGGTGTTCTCTGCCATCTCGAGATGGCAGAGAACACCACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-781s1c1
Sequence:CCGGCCATCTGAAGAAGGAGATAAACTCGAGTTTATCTCCTTCTTCAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005517
OR5K4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily K, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-729s1c1
Sequence:CCGGCCACTTTCTCTCTGTCTCAATCTCGAGATTGAGACAGAGAGAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-282s1c1
Sequence:CCGGGTATGAATGTATGGCACAATTCTCGAGAATTGTGCCATACATTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-536s1c1
Sequence:CCGGGTGATATTCTTCCACTGTATACTCGAGTATACAGTGGAAGAATATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-81s1c1
Sequence:CCGGGTTTGTGGTGTTCTCTGCCATCTCGAGATGGCAGAGAACACCACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-781s1c1
Sequence:CCGGCCATCTGAAGAAGGAGATAAACTCGAGTTTATCTCCTTCTTCAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005517
OR5K4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily K, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-729s1c1
Sequence:CCGGCCACTTTCTCTCTGTCTCAATCTCGAGATTGAGACAGAGAGAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-282s1c1
Sequence:CCGGGTATGAATGTATGGCACAATTCTCGAGAATTGTGCCATACATTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-536s1c1
Sequence:CCGGGTGATATTCTTCCACTGTATACTCGAGTATACAGTGGAAGAATATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-81s1c1
Sequence:CCGGGTTTGTGGTGTTCTCTGCCATCTCGAGATGGCAGAGAACACCACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005517.1-781s1c1
Sequence:CCGGCCATCTGAAGAAGGAGATAAACTCGAGTTTATCTCCTTCTTCAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)