EMAIL THIS PAGE TO A FRIEND

OR5M11

olfactory receptor, family 5, subfamily M, member 11

17 Gene Product Result for
Synonyms: OR11-199
UniProtKB ID: Q96RB7, B2RNL5, B2RNL7
Gene ID:
Human(219487) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(511623) olfactory receptor, family 5, subfamily M, member 11
dog(483520) olfactory receptor, family 5, subfamily M, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500847 Anti-OR5M11 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005245 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005245 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159423 predicted 661
2 SASI_Hs01_00159425 predicted 501
3 SASI_Hs01_00159427 predicted 310
4 SASI_Hs01_00159428 predicted 355
5 SASI_Hs02_00304809 predicted 312
6 SASI_Hs02_00304810 predicted 207
7 SASI_Hs01_00159430 predicted 199
8 SASI_Hs01_00159431 predicted 424
9 SASI_Hs02_00304811 predicted 631
10 SASI_Hs02_00304812 predicted 531
11 SASI_Hs01_00159424 predicted 546
12 SASI_Hs01_00159426 predicted 419
13 SASI_Hs01_00159429 predicted 585
14 SASI_Hs01_00159432 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005245
OR5M11 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily M, member 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-767s1c1
Sequence:CCGGGCATGTATATAAGACCACCAACTCGAGTTGGTGGTCTTATATACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-234s1c1
Sequence:CCGGCCCGCAGATGTCGACTAATATCTCGAGATATTAGTCGACATCTGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-313s1c1
Sequence:CCGGGCCCTTCTACTCACTGAGTTTCTCGAGAAACTCAGTGAGTAGAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-408s1c1
Sequence:CCGGCAGGAGAGTTTGCATCTGCTTCTCGAGAAGCAGATGCAAACTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-568s1c1
Sequence:CCGGGATACTTATGTCAAAGAGCATCTCGAGATGCTCTTTGACATAAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005245
OR5M11 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily M, member 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-767s1c1
Sequence:CCGGGCATGTATATAAGACCACCAACTCGAGTTGGTGGTCTTATATACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-234s1c1
Sequence:CCGGCCCGCAGATGTCGACTAATATCTCGAGATATTAGTCGACATCTGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-313s1c1
Sequence:CCGGGCCCTTCTACTCACTGAGTTTCTCGAGAAACTCAGTGAGTAGAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-408s1c1
Sequence:CCGGCAGGAGAGTTTGCATCTGCTTCTCGAGAAGCAGATGCAAACTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-568s1c1
Sequence:CCGGGATACTTATGTCAAAGAGCATCTCGAGATGCTCTTTGACATAAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005245
OR5M11 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily M, member 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-767s1c1
Sequence:CCGGGCATGTATATAAGACCACCAACTCGAGTTGGTGGTCTTATATACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-234s1c1
Sequence:CCGGCCCGCAGATGTCGACTAATATCTCGAGATATTAGTCGACATCTGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-313s1c1
Sequence:CCGGGCCCTTCTACTCACTGAGTTTCTCGAGAAACTCAGTGAGTAGAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-408s1c1
Sequence:CCGGCAGGAGAGTTTGCATCTGCTTCTCGAGAAGCAGATGCAAACTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005245.1-568s1c1
Sequence:CCGGGATACTTATGTCAAAGAGCATCTCGAGATGCTCTTTGACATAAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)