EMAIL THIS PAGE TO A FRIEND

OR5M9

olfactory receptor, family 5, subfamily M, member 9

15 Gene Product Result for
Synonyms: OR11-190
UniProtKB ID: Q8NGP3, Q6IEW5, Q96RB9
Gene ID:
Human(390162) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509895) olfactory receptor, family 5, subfamily M, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501698 Anti-OR5M9 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372397 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004743 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144769 predicted 440
2 SASI_Hs01_00144770 predicted 422
3 SASI_Hs01_00144772 predicted 421
4 SASI_Hs01_00144774 predicted 636
5 SASI_Hs01_00144775 predicted 307
6 SASI_Hs01_00144776 predicted 561
7 SASI_Hs01_00144777 predicted 414
8 SASI_Hs01_00144778 predicted 396
9 SASI_Hs02_00304694 predicted 647
10 SASI_Hs02_00304695 predicted 453
11 SASI_Hs01_00144771 predicted 589
12 SASI_Hs01_00144773 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372397
OR5M9 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily M, member 9
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000189331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-636s1c1
Sequence:CCGGCCTCATCTCCTACACTCTCATCTCGAGATGAGAGTGTAGGAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-570s1c1
Sequence:CCGGGCACATCAAAGAAATCACAATCTCGAGATTGTGATTTCTTTGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-156s1c1
Sequence:CCGGGCTTCAGAGTCCCATGTACTTCTCGAGAAGTACATGGGACTCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372397
OR5M9 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily M, member 9
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000189331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-636s1c1
Sequence:CCGGCCTCATCTCCTACACTCTCATCTCGAGATGAGAGTGTAGGAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-570s1c1
Sequence:CCGGGCACATCAAAGAAATCACAATCTCGAGATTGTGATTTCTTTGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-156s1c1
Sequence:CCGGGCTTCAGAGTCCCATGTACTTCTCGAGAAGTACATGGGACTCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372397
OR5M9 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily M, member 9
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000189331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-636s1c1
Sequence:CCGGCCTCATCTCCTACACTCTCATCTCGAGATGAGAGTGTAGGAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-570s1c1
Sequence:CCGGGCACATCAAAGAAATCACAATCTCGAGATTGTGATTTCTTTGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372397.1-156s1c1
Sequence:CCGGGCTTCAGAGTCCCATGTACTTCTCGAGAAGTACATGGGACTCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)