EMAIL THIS PAGE TO A FRIEND

OR5P2

olfactory receptor, family 5, subfamily P, member 2

19 Gene Product Result for
Synonyms: JCG3 JCG4
Species: Human OR5P2(120065)
UniProtKB ID: Q8WZ92, Q3MIS8
Gene ID:
Human(120065) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500295 Anti-OR5P2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153444 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234827 predicted 614
2 SASI_Hs01_00234828 predicted 456
3 SASI_Hs01_00234829 predicted 723
4 SASI_Hs01_00234831 predicted 407
5 SASI_Hs01_00234832 predicted 619
6 SASI_Hs01_00234834 predicted 459
7 SASI_Hs01_00234835 predicted 729
8 SASI_Hs02_00367282 predicted 542
9 SASI_Hs02_00367283 predicted 533
10 SASI_Hs02_00367284 predicted 597
11 SASI_Hs01_00234826 predicted 368
12 SASI_Hs01_00234830 predicted 208
13 SASI_Hs01_00234833 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153444
OR5P2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily P, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-462s21c1
Sequence:CCGGCTATACTACTTCCTTCTATTTCTCGAGAAATAGAAGGAAGTAGTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-373s1c1
Sequence:CCGGCCACTGCTTTATTCAACCAAACTCGAGTTTGGTTGAATAAAGCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-461s1c1
Sequence:CCGGCCTATACTACTTCCTTCTATTCTCGAGAATAGAAGGAAGTAGTATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-414s1c1
Sequence:CCGGCCAGCTACTCTTAGTAGTTTACTCGAGTAAACTACTAAGAGTAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-536s1c1
Sequence:CCGGCCTTACTTGAACTCTCCTGTTCTCGAGAACAGGAGAGTTCAAGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-94s21c1
Sequence:CCGGATGATCATCCTATCTGGTAATCTCGAGATTACCAGATAGGATGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-102s1c1
Sequence:CCGGCCTATCTGGTAATCTCAGCATCTCGAGATGCTGAGATTACCAGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-630s21c1
Sequence:CCGGAGCCGTCTGCTACATCTATATCTCGAGATATAGATGTAGCAGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153444
OR5P2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily P, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-462s21c1
Sequence:CCGGCTATACTACTTCCTTCTATTTCTCGAGAAATAGAAGGAAGTAGTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-373s1c1
Sequence:CCGGCCACTGCTTTATTCAACCAAACTCGAGTTTGGTTGAATAAAGCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-461s1c1
Sequence:CCGGCCTATACTACTTCCTTCTATTCTCGAGAATAGAAGGAAGTAGTATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-414s1c1
Sequence:CCGGCCAGCTACTCTTAGTAGTTTACTCGAGTAAACTACTAAGAGTAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-536s1c1
Sequence:CCGGCCTTACTTGAACTCTCCTGTTCTCGAGAACAGGAGAGTTCAAGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-94s21c1
Sequence:CCGGATGATCATCCTATCTGGTAATCTCGAGATTACCAGATAGGATGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-102s1c1
Sequence:CCGGCCTATCTGGTAATCTCAGCATCTCGAGATGCTGAGATTACCAGATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-630s21c1
Sequence:CCGGAGCCGTCTGCTACATCTATATCTCGAGATATAGATGTAGCAGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153444
OR5P2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily P, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-462s21c1
Sequence:CCGGCTATACTACTTCCTTCTATTTCTCGAGAAATAGAAGGAAGTAGTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-373s1c1
Sequence:CCGGCCACTGCTTTATTCAACCAAACTCGAGTTTGGTTGAATAAAGCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-461s1c1
Sequence:CCGGCCTATACTACTTCCTTCTATTCTCGAGAATAGAAGGAAGTAGTATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-414s1c1
Sequence:CCGGCCAGCTACTCTTAGTAGTTTACTCGAGTAAACTACTAAGAGTAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-536s1c1
Sequence:CCGGCCTTACTTGAACTCTCCTGTTCTCGAGAACAGGAGAGTTCAAGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-94s21c1
Sequence:CCGGATGATCATCCTATCTGGTAATCTCGAGATTACCAGATAGGATGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153444.1-102s1c1
Sequence:CCGGCCTATCTGGTAATCTCAGCATCTCGAGATGCTGAGATTACCAGATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153444.1-630s21c1
Sequence:CCGGAGCCGTCTGCTACATCTATATCTCGAGATATAGATGTAGCAGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)