EMAIL THIS PAGE TO A FRIEND

OR5P3

olfactory receptor, family 5, subfamily P, member 3

21 Gene Product Result for
Synonyms: JCG1
UniProtKB ID: Q8WZ94, Q6IFE1, Q8NGM2
Gene ID:
Human(120066) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(782978) olfactory receptor, family 5, subfamily P, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153445 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153445 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198127 predicted 592
2 SASI_Hs01_00198129 predicted 633
3 SASI_Hs01_00198130 predicted 489
4 SASI_Hs01_00198131 predicted 212
5 SASI_Hs01_00198132 predicted 200
6 SASI_Hs01_00198133 predicted 551
7 SASI_Hs01_00198134 predicted 553
8 SASI_Hs01_00198135 predicted 239
9 SASI_Hs01_00198136 predicted 552
10 SASI_Hs02_00367285 predicted 456
11 SASI_Hs01_00198128 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153445
OR5P3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily P, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-107s21c1
Sequence:CCGGTTGTCACCTTAATGGGTAATACTCGAGTATTACCCATTAAGGTGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-510s1c1
Sequence:CCGGGCCAAATAAAGTCAATCACTTCTCGAGAAGTGATTGACTTTATTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-108s1c1
Sequence:CCGGTGTCACCTTAATGGGTAATATCTCGAGATATTACCCATTAAGGTGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-483s1c1
Sequence:CCGGCTGCTTATTAAGACTGTCCTTCTCGAGAAGGACAGTCTTAATAAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-558s1c1
Sequence:CCGGGCTTGCTTGTTCCCATGATTTCTCGAGAAATCATGGGAACAAGCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-643s21c1
Sequence:CCGGGCCATATCCTACATCTATATCCTCGAGGATATAGATGTAGGATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-598s21c1
Sequence:CCGGGCTATCTCTTCTGGATCTATCCTCGAGGATAGATCCAGAAGAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-59s21c1
Sequence:CCGGATACTACAGTTTGTGCTATTTCTCGAGAAATAGCACAAACTGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153445
OR5P3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily P, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-107s21c1
Sequence:CCGGTTGTCACCTTAATGGGTAATACTCGAGTATTACCCATTAAGGTGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-510s1c1
Sequence:CCGGGCCAAATAAAGTCAATCACTTCTCGAGAAGTGATTGACTTTATTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-108s1c1
Sequence:CCGGTGTCACCTTAATGGGTAATATCTCGAGATATTACCCATTAAGGTGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-483s1c1
Sequence:CCGGCTGCTTATTAAGACTGTCCTTCTCGAGAAGGACAGTCTTAATAAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-558s1c1
Sequence:CCGGGCTTGCTTGTTCCCATGATTTCTCGAGAAATCATGGGAACAAGCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-643s21c1
Sequence:CCGGGCCATATCCTACATCTATATCCTCGAGGATATAGATGTAGGATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-598s21c1
Sequence:CCGGGCTATCTCTTCTGGATCTATCCTCGAGGATAGATCCAGAAGAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-59s21c1
Sequence:CCGGATACTACAGTTTGTGCTATTTCTCGAGAAATAGCACAAACTGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153445
OR5P3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily P, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-107s21c1
Sequence:CCGGTTGTCACCTTAATGGGTAATACTCGAGTATTACCCATTAAGGTGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-510s1c1
Sequence:CCGGGCCAAATAAAGTCAATCACTTCTCGAGAAGTGATTGACTTTATTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-108s1c1
Sequence:CCGGTGTCACCTTAATGGGTAATATCTCGAGATATTACCCATTAAGGTGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-483s1c1
Sequence:CCGGCTGCTTATTAAGACTGTCCTTCTCGAGAAGGACAGTCTTAATAAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153445.1-558s1c1
Sequence:CCGGGCTTGCTTGTTCCCATGATTTCTCGAGAAATCATGGGAACAAGCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-643s21c1
Sequence:CCGGGCCATATCCTACATCTATATCCTCGAGGATATAGATGTAGGATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-598s21c1
Sequence:CCGGGCTATCTCTTCTGGATCTATCCTCGAGGATAGATCCAGAAGAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153445.1-59s21c1
Sequence:CCGGATACTACAGTTTGTGCTATTTCTCGAGAAATAGCACAAACTGTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)