EMAIL THIS PAGE TO A FRIEND

OR5T3

olfactory receptor, family 5, subfamily T, member 3

10 Gene Product Result for
Synonyms: OR11-178 OR5T3Q
Species: Human OR5T3(390154)
UniProtKB ID: Q8NGG3, Q6IFC7
Gene ID:
Human(390154) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004747 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246611 predicted 287
2 SASI_Hs01_00246610 predicted 724
3 SASI_Hs01_00246612 predicted 843
4 SASI_Hs01_00246613 predicted 19
5 SASI_Hs01_00246614 predicted 923
6 SASI_Hs01_00246615 predicted 8
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004747
OR5T3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily T, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-94s1c1
Sequence:CCGGCCACTGAAGAACAAGACTGAACTCGAGTTCAGTCTTGTTCTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-732s1c1
Sequence:CCGGCCTCATTTCCTGTGATTTCATCTCGAGATGAAATCACAGGAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-154s1c1
Sequence:CCGGGAGCTGCAAGTCTTCCTATTTCTCGAGAAATAGGAAGACTTGCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-846s1c1
Sequence:CCGGTGGAACAATTCTCGTCAGTTACTCGAGTAACTGACGAGAATTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-27s1c1
Sequence:CCGGCCTTTATAACCTGCAAGTAAACTCGAGTTTACTTGCAGGTTATAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004747
OR5T3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily T, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-94s1c1
Sequence:CCGGCCACTGAAGAACAAGACTGAACTCGAGTTCAGTCTTGTTCTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-732s1c1
Sequence:CCGGCCTCATTTCCTGTGATTTCATCTCGAGATGAAATCACAGGAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-154s1c1
Sequence:CCGGGAGCTGCAAGTCTTCCTATTTCTCGAGAAATAGGAAGACTTGCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-846s1c1
Sequence:CCGGTGGAACAATTCTCGTCAGTTACTCGAGTAACTGACGAGAATTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-27s1c1
Sequence:CCGGCCTTTATAACCTGCAAGTAAACTCGAGTTTACTTGCAGGTTATAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004747
OR5T3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily T, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-94s1c1
Sequence:CCGGCCACTGAAGAACAAGACTGAACTCGAGTTCAGTCTTGTTCTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-732s1c1
Sequence:CCGGCCTCATTTCCTGTGATTTCATCTCGAGATGAAATCACAGGAAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-154s1c1
Sequence:CCGGGAGCTGCAAGTCTTCCTATTTCTCGAGAAATAGGAAGACTTGCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-846s1c1
Sequence:CCGGTGGAACAATTCTCGTCAGTTACTCGAGTAACTGACGAGAATTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004747.1-27s1c1
Sequence:CCGGCCTTTATAACCTGCAAGTAAACTCGAGTTTACTTGCAGGTTATAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)