EMAIL THIS PAGE TO A FRIEND

OR5V1

olfactory receptor, family 5, subfamily V, member 1

20 Gene Product Result for
Synonyms: 6M1-21 hs6M1-21
UniProtKB ID: Q9UGF6, A2BDZ0, B0S860, Q5SQI9, Q6NTB5, Q8IVL3
Gene ID:
Human(81696) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(785397) olfactory receptor, family 5, subfamily V, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030876 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061080 predicted 484
2 SASI_Hs01_00061081 predicted 445
3 SASI_Hs01_00061083 predicted 491
4 SASI_Hs01_00061084 predicted 231
5 SASI_Hs01_00061085 predicted 264
6 SASI_Hs02_00358410 predicted 443
7 SASI_Hs01_00061086 predicted 645
8 SASI_Hs01_00061087 predicted 455
9 SASI_Hs01_00061088 predicted 655
10 SASI_Hs01_00061089 predicted 630
11 SASI_Hs01_00061082 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030876
OR5V1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily V, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-492s1c1
Sequence:CCGGGCAAGGTTCTATGCAATCAATCTCGAGATTGATTGCATAGAACCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-634s1c1
Sequence:CCGGGCTGATCTTGTCTTGTGGAAACTCGAGTTTCCACAAGACAAGATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-168s1c1
Sequence:CCGGCCATCTTCTTTCTGACTTATTCTCGAGAATAAGTCAGAAAGAAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-710s1c1
Sequence:CCGGCCTTTCCTTTGTATCGTACTTCTCGAGAAGTACGATACAAAGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-720s21c1
Sequence:CCGGGTATCGTACTTTCCTACATTTCTCGAGAAATGTAGGAAAGTACGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-860s21c1
Sequence:CCGGGTACGGCCCATCTCAACTTACCTCGAGGTAAGTTGAGATGGGCCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-124s1c1
Sequence:CCGGCTTGGGATTCTCCAACCTAAACTCGAGTTTAGGTTGGAGAATCCCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-460s21c1
Sequence:CCGGCTGCAATCCTTTAAGGTATTCCTCGAGGAATACCTTAAAGGATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030876
OR5V1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily V, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-492s1c1
Sequence:CCGGGCAAGGTTCTATGCAATCAATCTCGAGATTGATTGCATAGAACCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-634s1c1
Sequence:CCGGGCTGATCTTGTCTTGTGGAAACTCGAGTTTCCACAAGACAAGATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-168s1c1
Sequence:CCGGCCATCTTCTTTCTGACTTATTCTCGAGAATAAGTCAGAAAGAAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-710s1c1
Sequence:CCGGCCTTTCCTTTGTATCGTACTTCTCGAGAAGTACGATACAAAGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-720s21c1
Sequence:CCGGGTATCGTACTTTCCTACATTTCTCGAGAAATGTAGGAAAGTACGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-860s21c1
Sequence:CCGGGTACGGCCCATCTCAACTTACCTCGAGGTAAGTTGAGATGGGCCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-124s1c1
Sequence:CCGGCTTGGGATTCTCCAACCTAAACTCGAGTTTAGGTTGGAGAATCCCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-460s21c1
Sequence:CCGGCTGCAATCCTTTAAGGTATTCCTCGAGGAATACCTTAAAGGATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030876
OR5V1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily V, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-492s1c1
Sequence:CCGGGCAAGGTTCTATGCAATCAATCTCGAGATTGATTGCATAGAACCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-634s1c1
Sequence:CCGGGCTGATCTTGTCTTGTGGAAACTCGAGTTTCCACAAGACAAGATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-168s1c1
Sequence:CCGGCCATCTTCTTTCTGACTTATTCTCGAGAATAAGTCAGAAAGAAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-710s1c1
Sequence:CCGGCCTTTCCTTTGTATCGTACTTCTCGAGAAGTACGATACAAAGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-720s21c1
Sequence:CCGGGTATCGTACTTTCCTACATTTCTCGAGAAATGTAGGAAAGTACGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-860s21c1
Sequence:CCGGGTACGGCCCATCTCAACTTACCTCGAGGTAAGTTGAGATGGGCCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030876.4-124s1c1
Sequence:CCGGCTTGGGATTCTCCAACCTAAACTCGAGTTTAGGTTGGAGAATCCCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030876.5-460s21c1
Sequence:CCGGCTGCAATCCTTTAAGGTATTCCTCGAGGAATACCTTAAAGGATTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)