EMAIL THIS PAGE TO A FRIEND

OR6A2

olfactory receptor, family 6, subfamily A, member 2

18 Gene Product Result for
Synonyms: I7 OR11-55 OR6A1 OR6A2P
UniProtKB ID: O95222, Q3MJC7, Q6IF35, Q9H206
Gene ID:
Human(8590) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(528930) olfactory receptor, family 6, subfamily A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003696 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150891 MISSION® esiRNA esiRNA human OR6A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003696 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171759 predicted 327
2 SASI_Hs01_00171760 predicted 1021
3 SASI_Hs01_00171761 predicted 354
4 SASI_Hs01_00171762 predicted 316
5 SASI_Hs01_00171763 predicted 778
6 SASI_Hs01_00171764 predicted 949
7 SASI_Hs01_00171765 predicted 1045
8 SASI_Hs01_00171766 predicted 1156
9 SASI_Hs01_00171767 predicted 1074
10 SASI_Hs01_00171768 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003696
OR6A2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily A, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-317s1c1
Sequence:CCGGGCTGACTGAGAACACACTCATCTCGAGATGAGTGTGTTCTCAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-726s1c1
Sequence:CCGGCCCAACATCATCAACCACTTTCTCGAGAAAGTGGTTGATGATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009431    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003696.2-1211s1c1
Sequence:CCGGGCTATTAAACTTGGGATCAATCTCGAGATTGATCCCAAGTTTAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-902s21c1
Sequence:CCGGTTCGGCTGCTGGACGCTATAACTCGAGTTATAGCGTCCAGCAGCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-1158s1c1
Sequence:CCGGCCCAAGAAAGCTAGCAGAAATCTCGAGATTTCTGCTAGCTTTCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-267s1c1
Sequence:CCGGCCACTACAGGTACTATTGTTTCTCGAGAAACAATAGTACCTGTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-322s21c1
Sequence:CCGGCTGAGAACACACTCATCATTACTCGAGTAATGATGAGTGTGTTCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-263s21c1
Sequence:CCGGTGCGCCACTACAGGTACTATTCTCGAGAATAGTACCTGTAGTGGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003696
OR6A2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily A, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-317s1c1
Sequence:CCGGGCTGACTGAGAACACACTCATCTCGAGATGAGTGTGTTCTCAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-726s1c1
Sequence:CCGGCCCAACATCATCAACCACTTTCTCGAGAAAGTGGTTGATGATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009431    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003696.2-1211s1c1
Sequence:CCGGGCTATTAAACTTGGGATCAATCTCGAGATTGATCCCAAGTTTAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-902s21c1
Sequence:CCGGTTCGGCTGCTGGACGCTATAACTCGAGTTATAGCGTCCAGCAGCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-1158s1c1
Sequence:CCGGCCCAAGAAAGCTAGCAGAAATCTCGAGATTTCTGCTAGCTTTCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-267s1c1
Sequence:CCGGCCACTACAGGTACTATTGTTTCTCGAGAAACAATAGTACCTGTAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-322s21c1
Sequence:CCGGCTGAGAACACACTCATCATTACTCGAGTAATGATGAGTGTGTTCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-263s21c1
Sequence:CCGGTGCGCCACTACAGGTACTATTCTCGAGAATAGTACCTGTAGTGGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003696
OR6A2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily A, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-317s1c1
Sequence:CCGGGCTGACTGAGAACACACTCATCTCGAGATGAGTGTGTTCTCAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-726s1c1
Sequence:CCGGCCCAACATCATCAACCACTTTCTCGAGAAAGTGGTTGATGATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009431    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003696.2-1211s1c1
Sequence:CCGGGCTATTAAACTTGGGATCAATCTCGAGATTGATCCCAAGTTTAATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-902s21c1
Sequence:CCGGTTCGGCTGCTGGACGCTATAACTCGAGTTATAGCGTCCAGCAGCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-1158s1c1
Sequence:CCGGCCCAAGAAAGCTAGCAGAAATCTCGAGATTTCTGCTAGCTTTCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003696.2-267s1c1
Sequence:CCGGCCACTACAGGTACTATTGTTTCTCGAGAAACAATAGTACCTGTAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-322s21c1
Sequence:CCGGCTGAGAACACACTCATCATTACTCGAGTAATGATGAGTGTGTTCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003696.2-263s21c1
Sequence:CCGGTGCGCCACTACAGGTACTATTCTCGAGAATAGTACCTGTAGTGGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)