EMAIL THIS PAGE TO A FRIEND

OR6B1

olfactory receptor, family 6, subfamily B, member 1

14 Gene Product Result for
Synonyms: OR7-3 OR7-9
UniProtKB ID: O95007, A4D2G2, B9EH47, Q6IFP6, Q96R38
Gene ID:
Human(135946) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(482725) olfactory receptor, family 6, subfamily B, member 1
cow(509170) olfactory receptor, family 6, subfamily B, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_069621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_069621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_069621 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005281 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095478 predicted 365
2 SASI_Hs01_00095479 predicted 654
3 SASI_Hs01_00095480 predicted 274
4 SASI_Hs01_00095481 predicted 530
5 SASI_Hs01_00095482 predicted 455
6 SASI_Hs01_00095483 predicted 283
7 SASI_Hs01_00095484 predicted 575
8 SASI_Hs01_00095485 predicted 425
9 SASI_Hs01_00095486 predicted 384
10 SASI_Hs01_00095487 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_069621
OR6B1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily B, member 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000204415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069621.7-267s1c1
Sequence:CCGGCCTGTCATCTTATCCTGGCTTCTCGAGAAGCCAGGATAAGATGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069621.7-513s1c1
Sequence:CCGGCAAGTTCATTCTGGTGGGATTCTCGAGAATCCCACCAGAATGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_069621
OR6B1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily B, member 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000204415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069621.7-267s1c1
Sequence:CCGGCCTGTCATCTTATCCTGGCTTCTCGAGAAGCCAGGATAAGATGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069621.7-513s1c1
Sequence:CCGGCAAGTTCATTCTGGTGGGATTCTCGAGAATCCCACCAGAATGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_069621
OR6B1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily B, member 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000204415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069621.7-267s1c1
Sequence:CCGGCCTGTCATCTTATCCTGGCTTCTCGAGAAGCCAGGATAAGATGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069621.7-513s1c1
Sequence:CCGGCAAGTTCATTCTGGTGGGATTCTCGAGAATCCCACCAGAATGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)