EMAIL THIS PAGE TO A FRIEND

OR6C6

olfactory receptor, family 6, subfamily C, member 6

15 Gene Product Result for
Species: Human OR6C6(283365)
UniProtKB ID: A6NF89
Gene ID:
Human(283365) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_210242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210242 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005493 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161909 predicted 637
2 SASI_Hs01_00161910 predicted 546
3 SASI_Hs01_00161911 predicted 562
4 SASI_Hs01_00161912 predicted 607
5 SASI_Hs01_00161913 predicted 370
6 SASI_Hs01_00161914 predicted 211
7 SASI_Hs01_00161915 predicted 435
8 SASI_Hs01_00161917 predicted 625
9 SASI_Hs01_00161918 predicted 704
10 SASI_Hs02_00304958 predicted 423
11 SASI_Hs01_00161916 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210242
OR6C6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily C, member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-424s1c1
Sequence:CCGGCTTGTACTTAGCTCTTGGGTACTCGAGTACCCAAGAGCTAAGTACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-78s1c1
Sequence:CCGGCCTGTTTCTATTTCTCAACTACTCGAGTAGTTGAGAAATAGAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-379s1c1
Sequence:CCGGCCACTGCATTATCCAATCATTCTCGAGAATGATTGGATAATGCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-54s1c1
Sequence:CCGGCCCACAGTTGCAAATTGTGATCTCGAGATCACAATTTGCAACTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-741s1c1
Sequence:CCGGCATGACATACGGTAGCTGTATCTCGAGATACAGCTACCGTATGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-723s1c2
Sequence:CCGGCCACATGATTGTTGTCTCCATCTCGAGATGGAGACAACAATCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-750s1c1
Sequence:CCGGCGGTAGCTGTATCTTTATGTACTCGAGTACATAAAGATACAGCTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-229s1c1
Sequence:CCGGCCTAGATTCTTGATAACCATTCTCGAGAATGGTTATCAAGAATCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210242
OR6C6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily C, member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-424s1c1
Sequence:CCGGCTTGTACTTAGCTCTTGGGTACTCGAGTACCCAAGAGCTAAGTACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-78s1c1
Sequence:CCGGCCTGTTTCTATTTCTCAACTACTCGAGTAGTTGAGAAATAGAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-379s1c1
Sequence:CCGGCCACTGCATTATCCAATCATTCTCGAGAATGATTGGATAATGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-54s1c1
Sequence:CCGGCCCACAGTTGCAAATTGTGATCTCGAGATCACAATTTGCAACTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-741s1c1
Sequence:CCGGCATGACATACGGTAGCTGTATCTCGAGATACAGCTACCGTATGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-723s1c2
Sequence:CCGGCCACATGATTGTTGTCTCCATCTCGAGATGGAGACAACAATCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-750s1c1
Sequence:CCGGCGGTAGCTGTATCTTTATGTACTCGAGTACATAAAGATACAGCTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-229s1c1
Sequence:CCGGCCTAGATTCTTGATAACCATTCTCGAGAATGGTTATCAAGAATCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210242
OR6C6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily C, member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-424s1c1
Sequence:CCGGCTTGTACTTAGCTCTTGGGTACTCGAGTACCCAAGAGCTAAGTACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-78s1c1
Sequence:CCGGCCTGTTTCTATTTCTCAACTACTCGAGTAGTTGAGAAATAGAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-379s1c1
Sequence:CCGGCCACTGCATTATCCAATCATTCTCGAGAATGATTGGATAATGCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-54s1c1
Sequence:CCGGCCCACAGTTGCAAATTGTGATCTCGAGATCACAATTTGCAACTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-741s1c1
Sequence:CCGGCATGACATACGGTAGCTGTATCTCGAGATACAGCTACCGTATGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-723s1c2
Sequence:CCGGCCACATGATTGTTGTCTCCATCTCGAGATGGAGACAACAATCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-750s1c1
Sequence:CCGGCGGTAGCTGTATCTTTATGTACTCGAGTACATAAAGATACAGCTACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210242.1-229s1c1
Sequence:CCGGCCTAGATTCTTGATAACCATTCTCGAGAATGGTTATCAAGAATCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)