EMAIL THIS PAGE TO A FRIEND

OR6C75

olfactory receptor, family 6, subfamily C, member 75

14 Gene Product Result for
UniProtKB ID: A6NL08
Gene ID:
Human(390323) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(613564) olfactory receptor, family 6, subfamily C, member 75
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101690 Anti-OR6C75 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, horse, human, mouse, rat, rabbit, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005497 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025285 predicted 749
2 SASI_Hs01_00025287 predicted 556
3 SASI_Hs01_00025288 predicted 838
4 SASI_Hs01_00025289 predicted 453
5 SASI_Hs01_00025290 predicted 225
6 SASI_Hs01_00025291 predicted 453
7 SASI_Hs01_00025292 predicted 678
8 SASI_Hs01_00025293 predicted 183
9 SASI_Hs01_00025294 predicted 675
10 SASI_Hs02_00304963 predicted 80
11 SASI_Hs01_00025286 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372460
OR6C75 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily C, member 75
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-740s1c1
Sequence:CCGGCCATCTCTTACAGTAGCTGTACTCGAGTACAGCTACTGTAAGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-741s1c1
Sequence:CCGGCATCTCTTACAGTAGCTGTATCTCGAGATACAGCTACTGTAAGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-229s1c1
Sequence:CCGGCCCAGATTCCTTGTCACTGTTCTCGAGAACAGTGACAAGGAATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-785s1c1
Sequence:CCGGCCAGAGAAAGGGTGACTTTAACTCGAGTTAAAGTCACCCTTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372460
OR6C75 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily C, member 75
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-740s1c1
Sequence:CCGGCCATCTCTTACAGTAGCTGTACTCGAGTACAGCTACTGTAAGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-741s1c1
Sequence:CCGGCATCTCTTACAGTAGCTGTATCTCGAGATACAGCTACTGTAAGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-229s1c1
Sequence:CCGGCCCAGATTCCTTGTCACTGTTCTCGAGAACAGTGACAAGGAATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-785s1c1
Sequence:CCGGCCAGAGAAAGGGTGACTTTAACTCGAGTTAAAGTCACCCTTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372460
OR6C75 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily C, member 75
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-740s1c1
Sequence:CCGGCCATCTCTTACAGTAGCTGTACTCGAGTACAGCTACTGTAAGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-741s1c1
Sequence:CCGGCATCTCTTACAGTAGCTGTATCTCGAGATACAGCTACTGTAAGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-229s1c1
Sequence:CCGGCCCAGATTCCTTGTCACTGTTCTCGAGAACAGTGACAAGGAATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372460.1-785s1c1
Sequence:CCGGCCAGAGAAAGGGTGACTTTAACTCGAGTTAAAGTCACCCTTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)