EMAIL THIS PAGE TO A FRIEND

OR6C76

olfactory receptor, family 6, subfamily C, member 76

14 Gene Product Result for
UniProtKB ID: A6NM76
Gene ID:
Human(390326) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(787797) olfactory receptor, family 6, subfamily C, member 76
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005183 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081449 predicted 401
2 SASI_Hs01_00081450 predicted 614
3 SASI_Hs01_00081451 predicted 599
4 SASI_Hs01_00081453 predicted 477
5 SASI_Hs01_00081454 predicted 270
6 SASI_Hs01_00081455 predicted 560
7 SASI_Hs01_00081456 predicted 646
8 SASI_Hs01_00081458 predicted 571
9 SASI_Hs02_00304748 predicted 540
10 SASI_Hs02_00304749 predicted 397
11 SASI_Hs01_00081452 predicted 606
12 SASI_Hs01_00081457 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372463
OR6C76 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily C, member 76
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-375s1c1
Sequence:CCGGGCCTCTGCATTATACAACCATCTCGAGATGGTTGTATAATGCAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-726s1c1
Sequence:CCGGGATTGTTGTCTCTATCTCTTACTCGAGTAAGAGATAGAGACAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-753s1c1
Sequence:CCGGCTGCATCTTCATGTATGTGAACTCGAGTTCACATACATGAAGATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-438s1c1
Sequence:CCGGGCTGGCTGGTTTCTTGGTAATCTCGAGATTACCAAGAAACCAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372463
OR6C76 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily C, member 76
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-375s1c1
Sequence:CCGGGCCTCTGCATTATACAACCATCTCGAGATGGTTGTATAATGCAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-726s1c1
Sequence:CCGGGATTGTTGTCTCTATCTCTTACTCGAGTAAGAGATAGAGACAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-753s1c1
Sequence:CCGGCTGCATCTTCATGTATGTGAACTCGAGTTCACATACATGAAGATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-438s1c1
Sequence:CCGGGCTGGCTGGTTTCTTGGTAATCTCGAGATTACCAAGAAACCAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372463
OR6C76 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily C, member 76
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-375s1c1
Sequence:CCGGGCCTCTGCATTATACAACCATCTCGAGATGGTTGTATAATGCAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-726s1c1
Sequence:CCGGGATTGTTGTCTCTATCTCTTACTCGAGTAAGAGATAGAGACAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-753s1c1
Sequence:CCGGCTGCATCTTCATGTATGTGAACTCGAGTTCACATACATGAAGATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372463.1-438s1c1
Sequence:CCGGGCTGGCTGGTTTCTTGGTAATCTCGAGATTACCAAGAAACCAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)