EMAIL THIS PAGE TO A FRIEND

OR6K2

olfactory receptor, family 6, subfamily K, member 2

16 Gene Product Result for
Synonyms: OR1-17
UniProtKB ID: Q8NGY2, B9EH33, Q6IFR6
Gene ID:
Human(81448) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(505209) olfactory receptor, family 6, subfamily K, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005279 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304826 predicted 595
2 SASI_Hs01_00098566 predicted 567
3 SASI_Hs01_00098567 predicted 724
4 SASI_Hs01_00098569 predicted 258
5 SASI_Hs01_00098571 predicted 257
6 SASI_Hs01_00098572 predicted 502
7 SASI_Hs02_00304827 predicted 650
8 SASI_Hs01_00098573 predicted 606
9 SASI_Hs01_00098574 predicted 721
10 SASI_Hs01_00098575 predicted 411
11 SASI_Hs01_00098568 predicted 591
12 SASI_Hs01_00098570 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005279
OR6K2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily K, member 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-422s1c1
Sequence:CCGGCCCAACTGACTTTAAGTTGCTCTCGAGAGCAACTTAAAGTCAGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-583s1c1
Sequence:CCGGGTCATGATTCAGGTAGTGGATCTCGAGATCCACTACCTGAATCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-670s1c1
Sequence:CCGGGCTGTAATTCTACGTATTCATCTCGAGATGAATACGTAGAATTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005279
OR6K2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily K, member 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000203922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-422s1c1
Sequence:CCGGCCCAACTGACTTTAAGTTGCTCTCGAGAGCAACTTAAAGTCAGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-583s1c1
Sequence:CCGGGTCATGATTCAGGTAGTGGATCTCGAGATCCACTACCTGAATCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-670s1c1
Sequence:CCGGGCTGTAATTCTACGTATTCATCTCGAGATGAATACGTAGAATTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005279
OR6K2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily K, member 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000203922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-422s1c1
Sequence:CCGGCCCAACTGACTTTAAGTTGCTCTCGAGAGCAACTTAAAGTCAGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-583s1c1
Sequence:CCGGGTCATGATTCAGGTAGTGGATCTCGAGATCCACTACCTGAATCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005279.1-670s1c1
Sequence:CCGGGCTGTAATTCTACGTATTCATCTCGAGATGAATACGTAGAATTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)