EMAIL THIS PAGE TO A FRIEND

OR6N2

olfactory receptor, family 6, subfamily N, member 2

20 Gene Product Result for
Synonyms: OR1-23
Species: Human OR6N2(81442)
UniProtKB ID: Q8NGY6, Q6IFR2
Gene ID:
Human(81442) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005278 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058571 MISSION® esiRNA esiRNA human ANKDD1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005278 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052669 predicted 580
2 SASI_Hs01_00052670 predicted 212
3 SASI_Hs02_00304822 predicted 326
4 SASI_Hs01_00052672 predicted 233
5 SASI_Hs02_00304823 predicted 218
6 SASI_Hs02_00304824 predicted 240
7 SASI_Hs02_00304825 predicted 573
8 SASI_Hs01_00052673 predicted 218
9 SASI_Hs01_00052674 predicted 283
10 SASI_Hs01_00052675 predicted 204
11 SASI_Hs01_00052668 predicted 607
12 SASI_Hs01_00052671 predicted 518
13 SASI_Hs01_00052676 predicted 300
14 SASI_Hs01_00052677 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005278
OR6N2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily N, member 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-386s1c1
Sequence:CCGGCCCTCCACTACCCTATAATTACTCGAGTAATTATAGGGTAGTGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-589s1c1
Sequence:CCGGCTGGTGGACTTTGCCATTAATCTCGAGATTAATGGCAAAGTCCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-200s1c1
Sequence:CCGGCCTTCTTGGAGTTGTGGTATACTCGAGTATACCACAACTCCAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005278
OR6N2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily N, member 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000203766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-386s1c1
Sequence:CCGGCCCTCCACTACCCTATAATTACTCGAGTAATTATAGGGTAGTGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-589s1c1
Sequence:CCGGCTGGTGGACTTTGCCATTAATCTCGAGATTAATGGCAAAGTCCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-200s1c1
Sequence:CCGGCCTTCTTGGAGTTGTGGTATACTCGAGTATACCACAACTCCAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005278
OR6N2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily N, member 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000203766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-386s1c1
Sequence:CCGGCCCTCCACTACCCTATAATTACTCGAGTAATTATAGGGTAGTGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-589s1c1
Sequence:CCGGCTGGTGGACTTTGCCATTAATCTCGAGATTAATGGCAAAGTCCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005278.1-200s1c1
Sequence:CCGGCCTTCTTGGAGTTGTGGTATACTCGAGTATACCACAACTCCAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)