EMAIL THIS PAGE TO A FRIEND

OR6T1

olfactory receptor, family 6, subfamily T, member 1

18 Gene Product Result for
Synonyms: OR11-277
UniProtKB ID: Q8NGN1, Q6IFE7
Gene ID:
Human(219874) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(787662) olfactory receptor, family 6, subfamily T, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005187 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231460 predicted 731
2 SASI_Hs01_00231461 predicted 523
3 SASI_Hs01_00231463 predicted 539
4 SASI_Hs01_00231464 predicted 521
5 SASI_Hs01_00231465 predicted 453
6 SASI_Hs01_00231466 predicted 301
7 SASI_Hs01_00231467 predicted 200
8 SASI_Hs01_00231468 predicted 212
9 SASI_Hs02_00304758 predicted 297
10 SASI_Hs02_00304759 predicted 733
11 SASI_Hs01_00231459 predicted 594
12 SASI_Hs01_00231462 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166781
OR6T1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily T, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-294s1c1
Sequence:CCGGCATCCAGTCCTACCTCTACTTCTCGAGAAGTAGAGGTAGGACTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-273s1c1
Sequence:CCGGCATCTCATTTGTCAGCTGCATCTCGAGATGCAGCTGACAAATGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-729s1c1
Sequence:CCGGGCATCTTACAGTGGTGGTCATCTCGAGATGACCACCACTGTAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-165s1c1
Sequence:CCGGGCACATACAGATGTACTTCTTCTCGAGAAGAAGTACATCTGTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166781
OR6T1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily T, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-294s1c1
Sequence:CCGGCATCCAGTCCTACCTCTACTTCTCGAGAAGTAGAGGTAGGACTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-273s1c1
Sequence:CCGGCATCTCATTTGTCAGCTGCATCTCGAGATGCAGCTGACAAATGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-729s1c1
Sequence:CCGGGCATCTTACAGTGGTGGTCATCTCGAGATGACCACCACTGTAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-165s1c1
Sequence:CCGGGCACATACAGATGTACTTCTTCTCGAGAAGAAGTACATCTGTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166781
OR6T1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily T, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-294s1c1
Sequence:CCGGCATCCAGTCCTACCTCTACTTCTCGAGAAGTAGAGGTAGGACTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-273s1c1
Sequence:CCGGCATCTCATTTGTCAGCTGCATCTCGAGATGCAGCTGACAAATGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-729s1c1
Sequence:CCGGGCATCTTACAGTGGTGGTCATCTCGAGATGACCACCACTGTAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166781.1-165s1c1
Sequence:CCGGGCACATACAGATGTACTTCTTCTCGAGAAGAAGTACATCTGTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)