EMAIL THIS PAGE TO A FRIEND

OR6V1

olfactory receptor, family 6, subfamily V, member 1

14 Gene Product Result for
Synonyms: GPR138
UniProtKB ID: Q8N148, A4D2I0, B9EH48, Q6IF70
Gene ID:
Human(346517) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(519437) olfactory receptor, family 6, subfamily V, member 1
dog(482741) olfactory receptor, family 6, subfamily V, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301641 ANTI-OR6V1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001667 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001667 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155009 predicted 396
2 SASI_Hs01_00155010 predicted 555
3 SASI_Hs01_00155011 predicted 599
4 SASI_Hs01_00155012 predicted 549
5 SASI_Hs01_00155013 predicted 194
6 SASI_Hs01_00155014 predicted 556
7 SASI_Hs01_00155015 predicted 275
8 SASI_Hs02_00303864 predicted 221
9 SASI_Hs01_00155017 predicted 287
10 SASI_Hs01_00155018 predicted 619
11 SASI_Hs01_00155016 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001667
OR6V1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily V, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-82s1c1
Sequence:CCGGCCCTTCCTCATGCTTTATCTTCTCGAGAAGATAAAGCATGAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-198s1c1
Sequence:CCGGGCTGGAGATCTTGGTAACCATCTCGAGATGGTTACCAAGATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-289s1c1
Sequence:CCGGGTCCAGTTCTACTTCCACTTTCTCGAGAAAGTGGAAGTAGAACTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-744s1c1
Sequence:CCGGCGGCTACAGTAGTACCATCTTCTCGAGAAGATGGTACTACTGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-573s1c1
Sequence:CCGGCCTGTTGGAATTCTGGGACTTCTCGAGAAGTCCCAGAATTCCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001667
OR6V1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily V, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-82s1c1
Sequence:CCGGCCCTTCCTCATGCTTTATCTTCTCGAGAAGATAAAGCATGAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-198s1c1
Sequence:CCGGGCTGGAGATCTTGGTAACCATCTCGAGATGGTTACCAAGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-289s1c1
Sequence:CCGGGTCCAGTTCTACTTCCACTTTCTCGAGAAAGTGGAAGTAGAACTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-744s1c1
Sequence:CCGGCGGCTACAGTAGTACCATCTTCTCGAGAAGATGGTACTACTGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-573s1c1
Sequence:CCGGCCTGTTGGAATTCTGGGACTTCTCGAGAAGTCCCAGAATTCCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001667
OR6V1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily V, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-82s1c1
Sequence:CCGGCCCTTCCTCATGCTTTATCTTCTCGAGAAGATAAAGCATGAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-198s1c1
Sequence:CCGGGCTGGAGATCTTGGTAACCATCTCGAGATGGTTACCAAGATCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-289s1c1
Sequence:CCGGGTCCAGTTCTACTTCCACTTTCTCGAGAAAGTGGAAGTAGAACTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-744s1c1
Sequence:CCGGCGGCTACAGTAGTACCATCTTCTCGAGAAGATGGTACTACTGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001667.1-573s1c1
Sequence:CCGGCCTGTTGGAATTCTGGGACTTCTCGAGAAGTCCCAGAATTCCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)