EMAIL THIS PAGE TO A FRIEND

OR6W1P

olfactory receptor, family 6, subfamily W, member 1 pseudogene

15 Gene Product Result for
Synonyms: OR6W1 sdolf
Species: Human OR6W1P(89883)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033519 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002140 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00375303 predicted 800
2 SASI_Hs02_00375304 predicted 611
3 SASI_Hs02_00375305 predicted 667
4 SASI_Hs02_00375306 predicted 1082
5 SASI_Hs02_00375307 predicted 859
6 SASI_Hs02_00375308 predicted 1099
7 SASI_Hs02_00375309 predicted 1084
8 SASI_Hs02_00375310 predicted 809
9 SASI_Hs02_00375311 predicted 790
10 SASI_Hs02_00375312 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033519
OR6W1P MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily W, member 1 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033519.1-948s1c1
Sequence:CCGGAGGGTGAGCCCTTGACAGGGCCTCGAGGCCCTGTCAAGGGCTCACCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-276s1c1
Sequence:CCGGCCAAATGCCTAACCCAGTCTTCTCGAGAAGACTGGGTTAGGCATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-787s1c1
Sequence:CCGGCCACTCCACATACCTCAACAACTCGAGTTGTTGAGGTATGTGGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-625s1c1
Sequence:CCGGGCTGCTTATCATCCTCTCCTACTCGAGTAGGAGAGGATGATAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-816s1c1
Sequence:CCGGCCATGGTGACTGCAATGGTAACTCGAGTTACCATTGCAGTCACCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033519
OR6W1P MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily W, member 1 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033519.1-948s1c1
Sequence:CCGGAGGGTGAGCCCTTGACAGGGCCTCGAGGCCCTGTCAAGGGCTCACCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-276s1c1
Sequence:CCGGCCAAATGCCTAACCCAGTCTTCTCGAGAAGACTGGGTTAGGCATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-787s1c1
Sequence:CCGGCCACTCCACATACCTCAACAACTCGAGTTGTTGAGGTATGTGGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-625s1c1
Sequence:CCGGGCTGCTTATCATCCTCTCCTACTCGAGTAGGAGAGGATGATAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-816s1c1
Sequence:CCGGCCATGGTGACTGCAATGGTAACTCGAGTTACCATTGCAGTCACCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033519
OR6W1P MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily W, member 1 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033519.1-948s1c1
Sequence:CCGGAGGGTGAGCCCTTGACAGGGCCTCGAGGCCCTGTCAAGGGCTCACCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-276s1c1
Sequence:CCGGCCAAATGCCTAACCCAGTCTTCTCGAGAAGACTGGGTTAGGCATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-787s1c1
Sequence:CCGGCCACTCCACATACCTCAACAACTCGAGTTGTTGAGGTATGTGGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-625s1c1
Sequence:CCGGGCTGCTTATCATCCTCTCCTACTCGAGTAGGAGAGGATGATAAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033519.1-816s1c1
Sequence:CCGGCCATGGTGACTGCAATGGTAACTCGAGTTACCATTGCAGTCACCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)