EMAIL THIS PAGE TO A FRIEND

OR6Y1

olfactory receptor, family 6, subfamily Y, member 1

13 Gene Product Result for
Synonyms: OR1-11 OR6Y2
UniProtKB ID: Q8NGX8, Q6IFS0
Gene ID:
Human(391112) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(520257) olfactory receptor, family 6, subfamily Y, member 1
dog(488613) olfactory receptor, family 6, subfamily Y, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301880 ANTI-OR6Y1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372799 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005189 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046805 predicted 749
2 SASI_Hs01_00046806 predicted 460
3 SASI_Hs01_00046807 predicted 478
4 SASI_Hs01_00046808 predicted 297
5 SASI_Hs01_00046809 predicted 666
6 SASI_Hs01_00046810 predicted 545
7 SASI_Hs01_00046811 predicted 327
8 SASI_Hs01_00046812 predicted 423
9 SASI_Hs01_00046813 predicted 454
10 SASI_Hs01_00046814 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372799
OR6Y1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily Y, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000193173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-529s1c2
Sequence:CCGGCCTCAGATCAATCACTACTTTCTCGAGAAAGTAGTGATTGATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-378s1c1
Sequence:CCGGCCGCTATGTAGCCATTTGTAACTCGAGTTACAAATGGCTACATAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-622s1c1
Sequence:CCGGGCCCTCATGGTCATTGCTATTCTCGAGAATAGCAATGACCATGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372799
OR6Y1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily Y, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000193173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-529s1c2
Sequence:CCGGCCTCAGATCAATCACTACTTTCTCGAGAAAGTAGTGATTGATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-378s1c1
Sequence:CCGGCCGCTATGTAGCCATTTGTAACTCGAGTTACAAATGGCTACATAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-622s1c1
Sequence:CCGGGCCCTCATGGTCATTGCTATTCTCGAGAATAGCAATGACCATGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372799
OR6Y1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily Y, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000193173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-529s1c2
Sequence:CCGGCCTCAGATCAATCACTACTTTCTCGAGAAAGTAGTGATTGATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-378s1c1
Sequence:CCGGCCGCTATGTAGCCATTTGTAACTCGAGTTACAAATGGCTACATAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372799.1-622s1c1
Sequence:CCGGGCCCTCATGGTCATTGCTATTCTCGAGAATAGCAATGACCATGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)