EMAIL THIS PAGE TO A FRIEND

OR7A10

olfactory receptor, family 7, subfamily A, member 10

14 Gene Product Result for
Synonyms: BC85395_3 OR19-18
UniProtKB ID: O76100, Q6IFP0, Q96R97
Gene ID:
Human(390892) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(513732) olfactory receptor, family 7, subfamily A, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501716 Anti-OR7A10 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005190 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101937 predicted 314
2 SASI_Hs01_00101938 predicted 431
3 SASI_Hs01_00101940 predicted 438
4 SASI_Hs01_00101941 predicted 455
5 SASI_Hs01_00101942 predicted 473
6 SASI_Hs01_00101943 predicted 435
7 SASI_Hs01_00101945 predicted 446
8 SASI_Hs01_00101946 predicted 316
9 SASI_Hs01_00101939 predicted 246
10 SASI_Hs02_00304762 predicted 506
11 SASI_Hs01_00101944 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372712
OR7A10 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 7, subfamily A, member 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-385s1c1
Sequence:CCGGCCTCTGCACTACATGGTCATTCTCGAGAATGACCATGTAGTGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-668s1c2
Sequence:CCGGCCTCCATACGTGCAATCTCATCTCGAGATGAGATTGCACGTATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-439s1c1
Sequence:CCGGGCATCCTGGATCATGAGTGTTCTCGAGAACACTCATGATCCAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-255s1c1
Sequence:CCGGCCAGACACACAACAAAGTCATCTCGAGATGACTTTGTTGTGTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-571s1c1
Sequence:CCGGGACACCTTTCTTAATGACATACTCGAGTATGTCATTAAGAAAGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372712
OR7A10 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 7, subfamily A, member 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-385s1c1
Sequence:CCGGCCTCTGCACTACATGGTCATTCTCGAGAATGACCATGTAGTGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-668s1c2
Sequence:CCGGCCTCCATACGTGCAATCTCATCTCGAGATGAGATTGCACGTATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-439s1c1
Sequence:CCGGGCATCCTGGATCATGAGTGTTCTCGAGAACACTCATGATCCAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-255s1c1
Sequence:CCGGCCAGACACACAACAAAGTCATCTCGAGATGACTTTGTTGTGTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-571s1c1
Sequence:CCGGGACACCTTTCTTAATGACATACTCGAGTATGTCATTAAGAAAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372712
OR7A10 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 7, subfamily A, member 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-385s1c1
Sequence:CCGGCCTCTGCACTACATGGTCATTCTCGAGAATGACCATGTAGTGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-668s1c2
Sequence:CCGGCCTCCATACGTGCAATCTCATCTCGAGATGAGATTGCACGTATGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-439s1c1
Sequence:CCGGGCATCCTGGATCATGAGTGTTCTCGAGAACACTCATGATCCAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-255s1c1
Sequence:CCGGCCAGACACACAACAAAGTCATCTCGAGATGACTTTGTTGTGTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372712.1-571s1c1
Sequence:CCGGGACACCTTTCTTAATGACATACTCGAGTATGTCATTAAGAAAGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)