EMAIL THIS PAGE TO A FRIEND

OR7A17

olfactory receptor, family 7, subfamily A, member 17

15 Gene Product Result for
Synonyms: BC85395_4 HTPCRX19
UniProtKB ID: O14581, Q6IFQ6, Q96R98
Gene ID:
Human(26333) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(484880) olfactory receptor, family 7, subfamily A, member 17
cow(788289) olfactory receptor, family 7, subfamily A, member 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030901 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030901 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142721 predicted 454
2 SASI_Hs01_00142722 predicted 234
3 SASI_Hs01_00142725 predicted 540
4 SASI_Hs01_00142726 predicted 256
5 SASI_Hs01_00142723 predicted 454
6 SASI_Hs01_00142724 predicted 541
7 SASI_Hs01_00142727 predicted 468
8 SASI_Hs01_00142728 predicted 879
9 SASI_Hs01_00142729 predicted 38
10 SASI_Hs01_00142730 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030901
OR7A17 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 7, subfamily A, member 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-229s1c1
Sequence:CCGGACAATCCCAAAGATGCTCATTCTCGAGAATGAGCATCTTTGGGATTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-764s1c1
Sequence:CCGGGCCTAGGTGTGTACCTTACTTCTCGAGAAGTAAGGTACACACCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-219s1c1
Sequence:CCGGCATCTCCACTACAATCCCAAACTCGAGTTTGGGATTGTAGTGGAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-458s1c1
Sequence:CCGGCCCTGAATTCCTTGTCACAAACTCGAGTTTGTGACAAGGAATTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-663s1c1
Sequence:CCGGAGTTTCCTCCATACGTGCAATCTCGAGATTGCACGTATGGAGGAAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-230s21c1
Sequence:CCGGCAATCCCAAAGATGCTCATTACTCGAGTAATGAGCATCTTTGGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-474s21c1
Sequence:CCGGACAAAGCTTAATGGTATTGTGCTCGAGCACAATACCATTAAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-434s21c1
Sequence:CCGGTTCTGGCATCCTGGATGATTGCTCGAGCAATCATCCAGGATGCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-380s21c1
Sequence:CCGGGTCATCCTCTGCACTACACAGCTCGAGCTGTGTAGTGCAGAGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030901
OR7A17 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 7, subfamily A, member 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-229s1c1
Sequence:CCGGACAATCCCAAAGATGCTCATTCTCGAGAATGAGCATCTTTGGGATTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-764s1c1
Sequence:CCGGGCCTAGGTGTGTACCTTACTTCTCGAGAAGTAAGGTACACACCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-219s1c1
Sequence:CCGGCATCTCCACTACAATCCCAAACTCGAGTTTGGGATTGTAGTGGAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-458s1c1
Sequence:CCGGCCCTGAATTCCTTGTCACAAACTCGAGTTTGTGACAAGGAATTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-663s1c1
Sequence:CCGGAGTTTCCTCCATACGTGCAATCTCGAGATTGCACGTATGGAGGAAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-230s21c1
Sequence:CCGGCAATCCCAAAGATGCTCATTACTCGAGTAATGAGCATCTTTGGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-474s21c1
Sequence:CCGGACAAAGCTTAATGGTATTGTGCTCGAGCACAATACCATTAAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-434s21c1
Sequence:CCGGTTCTGGCATCCTGGATGATTGCTCGAGCAATCATCCAGGATGCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-380s21c1
Sequence:CCGGGTCATCCTCTGCACTACACAGCTCGAGCTGTGTAGTGCAGAGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030901
OR7A17 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 7, subfamily A, member 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-229s1c1
Sequence:CCGGACAATCCCAAAGATGCTCATTCTCGAGAATGAGCATCTTTGGGATTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-764s1c1
Sequence:CCGGGCCTAGGTGTGTACCTTACTTCTCGAGAAGTAAGGTACACACCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-219s1c1
Sequence:CCGGCATCTCCACTACAATCCCAAACTCGAGTTTGGGATTGTAGTGGAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-458s1c1
Sequence:CCGGCCCTGAATTCCTTGTCACAAACTCGAGTTTGTGACAAGGAATTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030901.1-663s1c1
Sequence:CCGGAGTTTCCTCCATACGTGCAATCTCGAGATTGCACGTATGGAGGAAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-230s21c1
Sequence:CCGGCAATCCCAAAGATGCTCATTACTCGAGTAATGAGCATCTTTGGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-474s21c1
Sequence:CCGGACAAAGCTTAATGGTATTGTGCTCGAGCACAATACCATTAAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-434s21c1
Sequence:CCGGTTCTGGCATCCTGGATGATTGCTCGAGCAATCATCCAGGATGCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030901.1-380s21c1
Sequence:CCGGGTCATCCTCTGCACTACACAGCTCGAGCTGTGTAGTGCAGAGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)