EMAIL THIS PAGE TO A FRIEND

OR7G1

olfactory receptor, family 7, subfamily G, member 1

15 Gene Product Result for
Synonyms: OR19-15 OR19-8 OR7G1P
UniProtKB ID: Q8NGA0, Q6IFJ5, Q96RA1
Gene ID:
Human(125962) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(521914) olfactory receptor, family 7, subfamily G, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302200 ANTI-OR7G1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_064883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_064883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_064883 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005192 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191136 predicted 220
2 SASI_Hs01_00191137 predicted 559
3 SASI_Hs01_00191138 predicted 390
4 SASI_Hs01_00191139 predicted 294
5 SASI_Hs01_00191141 predicted 617
6 SASI_Hs01_00191142 predicted 689
7 SASI_Hs01_00191143 predicted 451
8 SASI_Hs02_00304766 predicted 666
9 SASI_Hs01_00191145 predicted 580
10 SASI_Hs02_00304767 predicted 392
11 SASI_Hs01_00191140 predicted 469
12 SASI_Hs01_00191144 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_064883
OR7G1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 7, subfamily G, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000187311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-685s1c1
Sequence:CCGGCCATCAGCAAGAGGAAAGTATCTCGAGATACTTTCCTCTTGCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-322s1c1
Sequence:CCGGGCTGGCTTGGAAAGTTGCTTTCTCGAGAAAGCAACTTTCCAAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-183s1c1
Sequence:CCGGCCTTCTCTTTAATCTCTCCTTCTCGAGAAGGAGAGATTAAAGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-61s1c1
Sequence:CCGGCCAGAACTGAAGTTAATCCCTCTCGAGAGGGATTAACTTCAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-576s1c1
Sequence:CCGGCCTCATCAACAACATCCTCATCTCGAGATGAGGATGTTGTTGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-577s1c1
Sequence:CCGGCTCATCAACAACATCCTCATACTCGAGTATGAGGATGTTGTTGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-684s1c1
Sequence:CCGGGCCATCAGCAAGAGGAAAGTACTCGAGTACTTTCCTCTTGCTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_064883
OR7G1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 7, subfamily G, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000187311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-685s1c1
Sequence:CCGGCCATCAGCAAGAGGAAAGTATCTCGAGATACTTTCCTCTTGCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-322s1c1
Sequence:CCGGGCTGGCTTGGAAAGTTGCTTTCTCGAGAAAGCAACTTTCCAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-183s1c1
Sequence:CCGGCCTTCTCTTTAATCTCTCCTTCTCGAGAAGGAGAGATTAAAGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-61s1c1
Sequence:CCGGCCAGAACTGAAGTTAATCCCTCTCGAGAGGGATTAACTTCAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-576s1c1
Sequence:CCGGCCTCATCAACAACATCCTCATCTCGAGATGAGGATGTTGTTGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-577s1c1
Sequence:CCGGCTCATCAACAACATCCTCATACTCGAGTATGAGGATGTTGTTGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-684s1c1
Sequence:CCGGGCCATCAGCAAGAGGAAAGTACTCGAGTACTTTCCTCTTGCTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_064883
OR7G1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 7, subfamily G, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000187311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-685s1c1
Sequence:CCGGCCATCAGCAAGAGGAAAGTATCTCGAGATACTTTCCTCTTGCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-322s1c1
Sequence:CCGGGCTGGCTTGGAAAGTTGCTTTCTCGAGAAAGCAACTTTCCAAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-183s1c1
Sequence:CCGGCCTTCTCTTTAATCTCTCCTTCTCGAGAAGGAGAGATTAAAGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-61s1c1
Sequence:CCGGCCAGAACTGAAGTTAATCCCTCTCGAGAGGGATTAACTTCAGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-576s1c1
Sequence:CCGGCCTCATCAACAACATCCTCATCTCGAGATGAGGATGTTGTTGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-577s1c1
Sequence:CCGGCTCATCAACAACATCCTCATACTCGAGTATGAGGATGTTGTTGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064883.9-684s1c1
Sequence:CCGGGCCATCAGCAAGAGGAAAGTACTCGAGTACTTTCCTCTTGCTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)