EMAIL THIS PAGE TO A FRIEND

OR8B2

olfactory receptor, family 8, subfamily B, member 2

14 Gene Product Result for
Synonyms: OR11-309 OR11-310
Species: Human OR8B2(26595)
UniProtKB ID: Q96RD0, Q8NGH2
Gene ID:
Human(26595) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501151 Anti-OR8B2 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005468 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005468 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236491 predicted 664
2 SASI_Hs01_00236492 predicted 629
3 SASI_Hs01_00236494 predicted 625
4 SASI_Hs01_00236495 predicted 210
5 SASI_Hs01_00236496 predicted 567
6 SASI_Hs01_00236497 predicted 404
7 SASI_Hs01_00236498 predicted 499
8 SASI_Hs01_00236499 predicted 710
9 SASI_Hs01_00236500 predicted 592
10 SASI_Hs02_00304932 predicted 488
11 SASI_Hs01_00236493 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005468
OR8B2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily B, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-763s1c1
Sequence:CCGGGCGGCATTCATGTATATTAAACTCGAGTTTAATATACATGAATGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-632s1c1
Sequence:CCGGGTTGTACCATCCTCATTTCTTCTCGAGAAGAAATGAGGATGGTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-165s1c1
Sequence:CCGGCCACACACCAATGTACTATTTCTCGAGAAATAGTACATTGGTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-243s1c1
Sequence:CCGGGCTAATGAACTTTGTGTCAAACTCGAGTTTGACACAAAGTTCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005468
OR8B2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily B, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-763s1c1
Sequence:CCGGGCGGCATTCATGTATATTAAACTCGAGTTTAATATACATGAATGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-632s1c1
Sequence:CCGGGTTGTACCATCCTCATTTCTTCTCGAGAAGAAATGAGGATGGTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-165s1c1
Sequence:CCGGCCACACACCAATGTACTATTTCTCGAGAAATAGTACATTGGTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-243s1c1
Sequence:CCGGGCTAATGAACTTTGTGTCAAACTCGAGTTTGACACAAAGTTCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005468
OR8B2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily B, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-763s1c1
Sequence:CCGGGCGGCATTCATGTATATTAAACTCGAGTTTAATATACATGAATGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-632s1c1
Sequence:CCGGGTTGTACCATCCTCATTTCTTCTCGAGAAGAAATGAGGATGGTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-165s1c1
Sequence:CCGGCCACACACCAATGTACTATTTCTCGAGAAATAGTACATTGGTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005468.1-243s1c1
Sequence:CCGGGCTAATGAACTTTGTGTCAAACTCGAGTTTGACACAAAGTTCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)