EMAIL THIS PAGE TO A FRIEND

OR8G5

olfactory receptor, family 8, subfamily G, member 5

19 Gene Product Result for
Synonyms: OR11-298 OR8G5P OR8G6
UniProtKB ID: Q8NG78, Q6IEU6
Gene ID:
Human(219865) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(516022) olfactory receptor, family 8, subfamily G, member 5
cow(505660) olfactory receptor, family 8, subfamily G, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500849 Anti-OR8G5 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005198 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005198 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304771 predicted 577
2 SASI_Hs02_00304772 predicted 578
3 SASI_Hs02_00304773 predicted 586
4 SASI_Hs01_00128107 predicted 747
5 SASI_Hs01_00128109 predicted 560
6 SASI_Hs02_00304774 predicted 568
7 SASI_Hs02_00304775 predicted 616
8 SASI_Hs01_00128110 predicted 667
9 SASI_Hs02_00304776 predicted 586
10 SASI_Hs01_00128112 predicted 572
11 SASI_Hs01_00128108 predicted 673
12 SASI_Hs01_00128111 predicted 664
13 SASI_Hs01_00128113 predicted 504
14 SASI_Hs01_00128114 predicted 565
15 SASI_Hs01_00128115 predicted 682
16 SASI_Hs01_00128116 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005198
OR8G5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily G, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-502s21c1
Sequence:CCGGAGCATCATCATATCCAATAAGCTCGAGCTTATTGGATATGATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-566s21c1
Sequence:CCGGTTTGTGCGTCAGCTCATATAGCTCGAGCTATATGAGCTGACGCACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-48s21c1
Sequence:CCGGCAATACAATTCACCTAAATACCTCGAGGTATTTAGGTGAATTGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-677s21c1
Sequence:CCGGGTACTTACATTAATGAGTTACCTCGAGGTAACTCATTAATGTAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-663s1c1
Sequence:CCGGGCTCTCCTGTTCTAGTACTTACTCGAGTAAGTACTAGAACAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-587s1c1
Sequence:CCGGGCTGTATGTTTAGGGTTCAATCTCGAGATTGAACCCTAAACATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-572s1c1
Sequence:CCGGCGTCAGCTCATATAGGCTGTACTCGAGTACAGCCTATATGAGCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-97s1c1
Sequence:CCGGCATCAAAGAATGGCAGCAGAACTCGAGTTCTGCTGCCATTCTTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-130s1c1
Sequence:CCGGGTGACTAAGTTTATTCTGGTTCTCGAGAACCAGAATAAACTTAGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005198
OR8G5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily G, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-502s21c1
Sequence:CCGGAGCATCATCATATCCAATAAGCTCGAGCTTATTGGATATGATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-566s21c1
Sequence:CCGGTTTGTGCGTCAGCTCATATAGCTCGAGCTATATGAGCTGACGCACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-48s21c1
Sequence:CCGGCAATACAATTCACCTAAATACCTCGAGGTATTTAGGTGAATTGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-677s21c1
Sequence:CCGGGTACTTACATTAATGAGTTACCTCGAGGTAACTCATTAATGTAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-663s1c1
Sequence:CCGGGCTCTCCTGTTCTAGTACTTACTCGAGTAAGTACTAGAACAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-587s1c1
Sequence:CCGGGCTGTATGTTTAGGGTTCAATCTCGAGATTGAACCCTAAACATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-572s1c1
Sequence:CCGGCGTCAGCTCATATAGGCTGTACTCGAGTACAGCCTATATGAGCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-97s1c1
Sequence:CCGGCATCAAAGAATGGCAGCAGAACTCGAGTTCTGCTGCCATTCTTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-130s1c1
Sequence:CCGGGTGACTAAGTTTATTCTGGTTCTCGAGAACCAGAATAAACTTAGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005198
OR8G5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily G, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-502s21c1
Sequence:CCGGAGCATCATCATATCCAATAAGCTCGAGCTTATTGGATATGATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-566s21c1
Sequence:CCGGTTTGTGCGTCAGCTCATATAGCTCGAGCTATATGAGCTGACGCACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-48s21c1
Sequence:CCGGCAATACAATTCACCTAAATACCTCGAGGTATTTAGGTGAATTGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005198.1-677s21c1
Sequence:CCGGGTACTTACATTAATGAGTTACCTCGAGGTAACTCATTAATGTAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-663s1c1
Sequence:CCGGGCTCTCCTGTTCTAGTACTTACTCGAGTAAGTACTAGAACAGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-587s1c1
Sequence:CCGGGCTGTATGTTTAGGGTTCAATCTCGAGATTGAACCCTAAACATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-572s1c1
Sequence:CCGGCGTCAGCTCATATAGGCTGTACTCGAGTACAGCCTATATGAGCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-97s1c1
Sequence:CCGGCATCAAAGAATGGCAGCAGAACTCGAGTTCTGCTGCCATTCTTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005198.1-130s1c1
Sequence:CCGGGTGACTAAGTTTATTCTGGTTCTCGAGAACCAGAATAAACTTAGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)