EMAIL THIS PAGE TO A FRIEND

OR8I2

olfactory receptor, family 8, subfamily I, member 2

14 Gene Product Result for
Synonyms: OR11-170
Species: Human OR8I2(120586)
UniProtKB ID: Q8N0Y5, B2RNN4, Q6IFC0, Q96RC5
Gene ID:
Human(120586) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_062162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_062162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_062162 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003750 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229205 predicted 229
2 SASI_Hs01_00229206 predicted 235
3 SASI_Hs01_00229207 predicted 223
4 SASI_Hs01_00229208 predicted 220
5 SASI_Hs01_00229209 predicted 230
6 SASI_Hs01_00229210 predicted 260
7 SASI_Hs01_00229211 predicted 230
8 SASI_Hs01_00229212 predicted 236
9 SASI_Hs01_00229213 predicted 240
10 SASI_Hs01_00229214 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_062162
OR8I2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily I, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-219s1c1
Sequence:CCGGCTCCTCTACTGTAACACCTAACTCGAGTTAGGTGTTACAGTAGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-630s1c1
Sequence:CCGGCCTTATCATCACAGTCACTTACTCGAGTAAGTGACTGTGATGATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-61s1c1
Sequence:CCGGCCTGAATTACAAGTCAGTCTTCTCGAGAAGACTGACTTGTAATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-429s1c1
Sequence:CCGGGCTGGGAGTAATGCCATATGTCTCGAGACATATGGCATTACTCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-565s1c1
Sequence:CCGGGTAGATACATTCGGCACAGAACTCGAGTTCTGTGCCGAATGTATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-265s1c1
Sequence:CCGGCGGAGATCCATCTCCTTTGTTCTCGAGAACAAAGGAGATGGATCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_062162
OR8I2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily I, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-219s1c1
Sequence:CCGGCTCCTCTACTGTAACACCTAACTCGAGTTAGGTGTTACAGTAGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-630s1c1
Sequence:CCGGCCTTATCATCACAGTCACTTACTCGAGTAAGTGACTGTGATGATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-61s1c1
Sequence:CCGGCCTGAATTACAAGTCAGTCTTCTCGAGAAGACTGACTTGTAATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-429s1c1
Sequence:CCGGGCTGGGAGTAATGCCATATGTCTCGAGACATATGGCATTACTCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-565s1c1
Sequence:CCGGGTAGATACATTCGGCACAGAACTCGAGTTCTGTGCCGAATGTATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-265s1c1
Sequence:CCGGCGGAGATCCATCTCCTTTGTTCTCGAGAACAAAGGAGATGGATCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_062162
OR8I2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily I, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-219s1c1
Sequence:CCGGCTCCTCTACTGTAACACCTAACTCGAGTTAGGTGTTACAGTAGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-630s1c1
Sequence:CCGGCCTTATCATCACAGTCACTTACTCGAGTAAGTGACTGTGATGATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-61s1c1
Sequence:CCGGCCTGAATTACAAGTCAGTCTTCTCGAGAAGACTGACTTGTAATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-429s1c1
Sequence:CCGGGCTGGGAGTAATGCCATATGTCTCGAGACATATGGCATTACTCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-565s1c1
Sequence:CCGGGTAGATACATTCGGCACAGAACTCGAGTTCTGTGCCGAATGTATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_062162.1-265s1c1
Sequence:CCGGCGGAGATCCATCTCCTTTGTTCTCGAGAACAAAGGAGATGGATCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)