EMAIL THIS PAGE TO A FRIEND

OR8J3

olfactory receptor, family 8, subfamily J, member 3

17 Gene Product Result for
Synonyms: OR11-173
Species: Human OR8J3(81168)
UniProtKB ID: Q8NGG0, Q6IFB6, Q96RC2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004064 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148021 MISSION® esiRNA esiRNA human OR8J3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004064 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059784 predicted 716
2 SASI_Hs01_00059785 predicted 580
3 SASI_Hs01_00059788 predicted 466
4 SASI_Hs01_00059789 predicted 673
5 SASI_Hs01_00059790 predicted 526
6 SASI_Hs01_00059791 predicted 479
7 SASI_Hs01_00059792 predicted 472
8 SASI_Hs01_00059793 predicted 872
9 SASI_Hs02_00304459 predicted 196
10 SASI_Hs02_00304460 predicted 181
11 SASI_Hs01_00059786 predicted 582
12 SASI_Hs01_00059787 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004064
OR8J3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily J, member 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-753s1c1
Sequence:CCGGCTATGGGACAATGCTATTTATCTCGAGATAAATAGCATTGTCCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-579s1c1
Sequence:CCGGCATACCAGAAACAATAGTCTTCTCGAGAAGACTATTGTTTCTGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-605s1c1
Sequence:CCGGCTGCAGCAACAAATTTGGTTTCTCGAGAAACCAAATTTGTTGCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-545s1c1
Sequence:CCGGCACCTCTGTTAGCATTATCTTCTCGAGAAGATAATGCTAACAGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004064
OR8J3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily J, member 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-753s1c1
Sequence:CCGGCTATGGGACAATGCTATTTATCTCGAGATAAATAGCATTGTCCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-579s1c1
Sequence:CCGGCATACCAGAAACAATAGTCTTCTCGAGAAGACTATTGTTTCTGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-605s1c1
Sequence:CCGGCTGCAGCAACAAATTTGGTTTCTCGAGAAACCAAATTTGTTGCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-545s1c1
Sequence:CCGGCACCTCTGTTAGCATTATCTTCTCGAGAAGATAATGCTAACAGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004064
OR8J3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily J, member 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-753s1c1
Sequence:CCGGCTATGGGACAATGCTATTTATCTCGAGATAAATAGCATTGTCCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-579s1c1
Sequence:CCGGCATACCAGAAACAATAGTCTTCTCGAGAAGACTATTGTTTCTGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-605s1c1
Sequence:CCGGCTGCAGCAACAAATTTGGTTTCTCGAGAAACCAAATTTGTTGCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004064.1-545s1c1
Sequence:CCGGCACCTCTGTTAGCATTATCTTCTCGAGAAGATAATGCTAACAGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)