EMAIL THIS PAGE TO A FRIEND

OR8K1

olfactory receptor, family 8, subfamily K, member 1

17 Gene Product Result for
Synonyms: OR11-182 OR8N1P
Species: Human OR8K1(390157)
UniProtKB ID: Q8NGG5, B9EJB1, Q6IFC3, Q96RC1
Gene ID:
Human(390157) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372395 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119601 MISSION® esiRNA esiRNA human OR8K1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002907 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140941 predicted 486
2 SASI_Hs01_00140942 predicted 524
3 SASI_Hs01_00140943 predicted 198
4 SASI_Hs01_00140944 predicted 609
5 SASI_Hs01_00140945 predicted 452
6 SASI_Hs01_00140946 predicted 527
7 SASI_Hs01_00140947 predicted 253
8 SASI_Hs01_00140948 predicted 588
9 SASI_Hs01_00140949 predicted 285
10 SASI_Hs01_00140950 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372395
OR8K1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily K, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-252s1c1
Sequence:CCGGCCCGAAGATGTTAGTAAACTTCTCGAGAAGTTTACTAACATCTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-689s1c1
Sequence:CCGGCCATTCTCAGAATGAACTCAACTCGAGTTGAGTTCATTCTGAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-711s1c2
Sequence:CCGGGAAAGGGAGGTACAAAGCCTTCTCGAGAAGGCTTTGTACCTCCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372395
OR8K1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily K, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000203358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-252s1c1
Sequence:CCGGCCCGAAGATGTTAGTAAACTTCTCGAGAAGTTTACTAACATCTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-689s1c1
Sequence:CCGGCCATTCTCAGAATGAACTCAACTCGAGTTGAGTTCATTCTGAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-711s1c2
Sequence:CCGGGAAAGGGAGGTACAAAGCCTTCTCGAGAAGGCTTTGTACCTCCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372395
OR8K1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily K, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000203358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-252s1c1
Sequence:CCGGCCCGAAGATGTTAGTAAACTTCTCGAGAAGTTTACTAACATCTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-689s1c1
Sequence:CCGGCCATTCTCAGAATGAACTCAACTCGAGTTGAGTTCATTCTGAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372395.1-711s1c2
Sequence:CCGGGAAAGGGAGGTACAAAGCCTTCTCGAGAAGGCTTTGTACCTCCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)