EMAIL THIS PAGE TO A FRIEND

OR8K3

olfactory receptor, family 8, subfamily K, member 3

14 Gene Product Result for
Synonyms: OR11-181
UniProtKB ID: Q8NH51, Q6IFC4
Gene ID:
Human(219473) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483534) cOR8V11 olfactory receptor family 8 subfamily V-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302090 ANTI-OR8K3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166825 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150871 MISSION® esiRNA esiRNA human OR8K3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005202 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032779 predicted 597
2 SASI_Hs01_00032780 predicted 571
3 SASI_Hs01_00032781 predicted 466
4 SASI_Hs01_00032782 predicted 423
5 SASI_Hs01_00032783 predicted 213
6 SASI_Hs01_00032784 predicted 433
7 SASI_Hs01_00032785 predicted 544
8 SASI_Hs01_00032786 predicted 468
9 SASI_Hs01_00032787 predicted 444
10 SASI_Hs01_00032788 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166825
OR8K3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily K, member 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000187886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-69s1c1
Sequence:CCGGGCAGGCACCATTATTTGCATTCTCGAGAATGCAAATAATGGTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-304s1c1
Sequence:CCGGGCTTTCTTTCTTGTGTTCATTCTCGAGAATGAACACAAGAAAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-667s1c1
Sequence:CCGGGTAGCCATTCTCAGGATGAATCTCGAGATTCATCCTGAGAATGGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-199s1c1
Sequence:CCGGGCTTTCATGGATCTTGGTTATCTCGAGATAACCAAGATCCATGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166825
OR8K3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily K, member 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000187886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-69s1c1
Sequence:CCGGGCAGGCACCATTATTTGCATTCTCGAGAATGCAAATAATGGTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-304s1c1
Sequence:CCGGGCTTTCTTTCTTGTGTTCATTCTCGAGAATGAACACAAGAAAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-667s1c1
Sequence:CCGGGTAGCCATTCTCAGGATGAATCTCGAGATTCATCCTGAGAATGGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-199s1c1
Sequence:CCGGGCTTTCATGGATCTTGGTTATCTCGAGATAACCAAGATCCATGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166825
OR8K3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily K, member 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000187886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-69s1c1
Sequence:CCGGGCAGGCACCATTATTTGCATTCTCGAGAATGCAAATAATGGTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-304s1c1
Sequence:CCGGGCTTTCTTTCTTGTGTTCATTCTCGAGAATGAACACAAGAAAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-667s1c1
Sequence:CCGGGTAGCCATTCTCAGGATGAATCTCGAGATTCATCCTGAGAATGGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166825.1-199s1c1
Sequence:CCGGGCTTTCATGGATCTTGGTTATCTCGAGATAACCAAGATCCATGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)