EMAIL THIS PAGE TO A FRIEND

OR8K5

olfactory receptor, family 8, subfamily K, member 5

13 Gene Product Result for
Synonyms: OR11-174
Species: Human OR8K5(219453)
UniProtKB ID: Q8NH50, Q6IFB5
Gene ID:
Human(219453) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166813 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004058 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012061 predicted 493
2 SASI_Hs01_00012062 predicted 559
3 SASI_Hs01_00012064 predicted 547
4 SASI_Hs01_00012065 predicted 420
5 SASI_Hs01_00012066 predicted 371
6 SASI_Hs02_00304453 predicted 546
7 SASI_Hs01_00012067 predicted 579
8 SASI_Hs01_00012068 predicted 623
9 SASI_Hs01_00012069 predicted 415
10 SASI_Hs01_00012070 predicted 450
11 SASI_Hs01_00012063 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166813
OR8K5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily K, member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1715s1c1
Sequence:CCGGCCATGATTACAGTTCTAGTATCTCGAGATACTAGAACTGTAATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-847s1c1
Sequence:CCGGCCCATGCTTAACCCTTTGATTCTCGAGAATCAAAGGGTTAAGCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1881s1c1
Sequence:CCGGCCACTCACTGGATACTGATAACTCGAGTTATCAGTATCCAGTGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-159s1c1
Sequence:CCGGCCACTTACATACACCTATGTACTCGAGTACATAGGTGTATGTAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1279s1c1
Sequence:CCGGCATCTAGCTATCATCAATCTTCTCGAGAAGATTGATGATAGCTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166813
OR8K5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily K, member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1715s1c1
Sequence:CCGGCCATGATTACAGTTCTAGTATCTCGAGATACTAGAACTGTAATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-847s1c1
Sequence:CCGGCCCATGCTTAACCCTTTGATTCTCGAGAATCAAAGGGTTAAGCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1881s1c1
Sequence:CCGGCCACTCACTGGATACTGATAACTCGAGTTATCAGTATCCAGTGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-159s1c1
Sequence:CCGGCCACTTACATACACCTATGTACTCGAGTACATAGGTGTATGTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1279s1c1
Sequence:CCGGCATCTAGCTATCATCAATCTTCTCGAGAAGATTGATGATAGCTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166813
OR8K5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily K, member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1715s1c1
Sequence:CCGGCCATGATTACAGTTCTAGTATCTCGAGATACTAGAACTGTAATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-847s1c1
Sequence:CCGGCCCATGCTTAACCCTTTGATTCTCGAGAATCAAAGGGTTAAGCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1881s1c1
Sequence:CCGGCCACTCACTGGATACTGATAACTCGAGTTATCAGTATCCAGTGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-159s1c1
Sequence:CCGGCCACTTACATACACCTATGTACTCGAGTACATAGGTGTATGTAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166813.3-1279s1c1
Sequence:CCGGCATCTAGCTATCATCAATCTTCTCGAGAAGATTGATGATAGCTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)