EMAIL THIS PAGE TO A FRIEND

OR8U8

olfactory receptor, family 8, subfamily U, member 8

16 Gene Product Result for
Species: Human OR8U8(504189)
UniProtKB ID: P0C7N1
Gene ID:
Human(504189) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013356 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151201 MISSION® esiRNA esiRNA human OR8U8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013356 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144337 predicted 415
2 SASI_Hs01_00144338 predicted 421
3 SASI_Hs01_00144341 predicted 448
4 SASI_Hs01_00144342 predicted 301
5 SASI_Hs01_00144343 predicted 267
6 SASI_Hs01_00144345 predicted 318
7 SASI_Hs02_00306339 predicted 609
8 SASI_Hs02_00306340 predicted 303
9 SASI_Hs02_00306341 predicted 626
10 SASI_Hs01_00144346 predicted 423
11 SASI_Hs01_00144339 predicted 223
12 SASI_Hs01_00144340 predicted 210
13 SASI_Hs01_00144344 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013356
OR8U8 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily U, member 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-51s1c1
Sequence:CCGGCACAGACCATCAGGAGTTGAACTCGAGTTCAACTCCTGATGGTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-313s1c1
Sequence:CCGGCTCACCTTCATGGTATCAGAACTCGAGTTCTGATACCATGAAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-736s1c1
Sequence:CCGGCTGGCAGTCACCATATTCTATCTCGAGATAGAATATGGTGACTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-243s1c1
Sequence:CCGGGCTTGGGAATTTCTTGTACAACTCGAGTTGTACAAGAAATTCCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-525s1c1
Sequence:CCGGCCATTTCTATTGTGATGACATCTCGAGATGTCATCACAATAGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-427s1c1
Sequence:CCGGCAACTTGTAGCAGTTCCTTATCTCGAGATAAGGAACTGCTACAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013356
OR8U8 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily U, member 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-51s1c1
Sequence:CCGGCACAGACCATCAGGAGTTGAACTCGAGTTCAACTCCTGATGGTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-313s1c1
Sequence:CCGGCTCACCTTCATGGTATCAGAACTCGAGTTCTGATACCATGAAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-736s1c1
Sequence:CCGGCTGGCAGTCACCATATTCTATCTCGAGATAGAATATGGTGACTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-243s1c1
Sequence:CCGGGCTTGGGAATTTCTTGTACAACTCGAGTTGTACAAGAAATTCCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-525s1c1
Sequence:CCGGCCATTTCTATTGTGATGACATCTCGAGATGTCATCACAATAGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-427s1c1
Sequence:CCGGCAACTTGTAGCAGTTCCTTATCTCGAGATAAGGAACTGCTACAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013356
OR8U8 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily U, member 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-51s1c1
Sequence:CCGGCACAGACCATCAGGAGTTGAACTCGAGTTCAACTCCTGATGGTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-313s1c1
Sequence:CCGGCTCACCTTCATGGTATCAGAACTCGAGTTCTGATACCATGAAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-736s1c1
Sequence:CCGGCTGGCAGTCACCATATTCTATCTCGAGATAGAATATGGTGACTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-243s1c1
Sequence:CCGGGCTTGGGAATTTCTTGTACAACTCGAGTTGTACAAGAAATTCCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-525s1c1
Sequence:CCGGCCATTTCTATTGTGATGACATCTCGAGATGTCATCACAATAGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013356.1-427s1c1
Sequence:CCGGCAACTTGTAGCAGTTCCTTATCTCGAGATAAGGAACTGCTACAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)