EMAIL THIS PAGE TO A FRIEND

OR8U9

olfactory receptor, family 8, subfamily U, member 9

7 Gene Product Result for
Species: Human OR8U9(504190)
UniProtKB ID: P0C7N5
Gene ID:
Human(504190) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013357 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306342 predicted 300
2 SASI_Hs02_00306343 predicted 377
3 SASI_Hs02_00306344 predicted 121
4 SASI_Hs02_00306345 predicted 764
5 SASI_Hs02_00306346 predicted 112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013357
OR8U9 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily U, member 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-412s1c1
Sequence:CCGGCCAGGAATCTGCATTCAGCTTCTCGAGAAGCTGAATGCAGATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-385s1c1
Sequence:CCGGCCTCTGATGTATATGGTGGTACTCGAGTACCACCATATACATCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-445s1c1
Sequence:CCGGCATAGCTATAGCATCTTGGTTCTCGAGAACCAAGATGCTATAGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-654s1c1
Sequence:CCGGCATGTTCATCATTTCTGCCATCTCGAGATGGCAGAAATGATGAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-183s1c1
Sequence:CCGGCTTTCTTAGCAACCTAGCTTTCTCGAGAAAGCTAGGTTGCTAAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-646s1c1
Sequence:CCGGGTCTCCTACATGTTCATCATTCTCGAGAATGATGAACATGTAGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013357
OR8U9 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily U, member 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-412s1c1
Sequence:CCGGCCAGGAATCTGCATTCAGCTTCTCGAGAAGCTGAATGCAGATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-385s1c1
Sequence:CCGGCCTCTGATGTATATGGTGGTACTCGAGTACCACCATATACATCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-445s1c1
Sequence:CCGGCATAGCTATAGCATCTTGGTTCTCGAGAACCAAGATGCTATAGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-654s1c1
Sequence:CCGGCATGTTCATCATTTCTGCCATCTCGAGATGGCAGAAATGATGAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-183s1c1
Sequence:CCGGCTTTCTTAGCAACCTAGCTTTCTCGAGAAAGCTAGGTTGCTAAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-646s1c1
Sequence:CCGGGTCTCCTACATGTTCATCATTCTCGAGAATGATGAACATGTAGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013357
OR8U9 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily U, member 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-412s1c1
Sequence:CCGGCCAGGAATCTGCATTCAGCTTCTCGAGAAGCTGAATGCAGATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-385s1c1
Sequence:CCGGCCTCTGATGTATATGGTGGTACTCGAGTACCACCATATACATCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-445s1c1
Sequence:CCGGCATAGCTATAGCATCTTGGTTCTCGAGAACCAAGATGCTATAGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-654s1c1
Sequence:CCGGCATGTTCATCATTTCTGCCATCTCGAGATGGCAGAAATGATGAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-183s1c1
Sequence:CCGGCTTTCTTAGCAACCTAGCTTTCTCGAGAAAGCTAGGTTGCTAAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013357.1-646s1c1
Sequence:CCGGGTCTCCTACATGTTCATCATTCTCGAGAATGATGAACATGTAGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)