EMAIL THIS PAGE TO A FRIEND

OR9A4

olfactory receptor, family 9, subfamily A, member 4

14 Gene Product Result for
UniProtKB ID: Q8NGU2, B9EGV6, Q6IFI4
Gene ID:
Human(130075) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509207) olfactory receptor, family 9, subfamily A, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301673 ANTI-OR9A4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_065555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_065555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_065555 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001656 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079914 predicted 254
2 SASI_Hs01_00079915 predicted 282
3 SASI_Hs01_00079916 predicted 253
4 SASI_Hs01_00079917 predicted 284
5 SASI_Hs01_00079918 predicted 289
6 SASI_Hs01_00079919 predicted 253
7 SASI_Hs01_00079920 predicted 250
8 SASI_Hs01_00079921 predicted 264
9 SASI_Hs01_00079923 predicted 247
10 SASI_Hs02_00303851 predicted 245
11 SASI_Hs01_00079922 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_065555
OR9A4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 9, subfamily A, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-495s1c1
Sequence:CCGGGCTTACTTACTGCAAATCAAACTCGAGTTTGATTTGCAGTAAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-507s1c1
Sequence:CCGGCAAATCAAATGTGGTGAACAACTCGAGTTGTTCACCACATTTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-53s1c1
Sequence:CCGGGCTCTGAAGAACTACATCATACTCGAGTATGATGTAGTTCTTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-553s1c1
Sequence:CCGGCTCAAACTATCCTGCAATAATCTCGAGATTATTGCAGGATAGTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_065555
OR9A4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 9, subfamily A, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-495s1c1
Sequence:CCGGGCTTACTTACTGCAAATCAAACTCGAGTTTGATTTGCAGTAAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-507s1c1
Sequence:CCGGCAAATCAAATGTGGTGAACAACTCGAGTTGTTCACCACATTTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-53s1c1
Sequence:CCGGGCTCTGAAGAACTACATCATACTCGAGTATGATGTAGTTCTTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-553s1c1
Sequence:CCGGCTCAAACTATCCTGCAATAATCTCGAGATTATTGCAGGATAGTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_065555
OR9A4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 9, subfamily A, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-495s1c1
Sequence:CCGGGCTTACTTACTGCAAATCAAACTCGAGTTTGATTTGCAGTAAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-507s1c1
Sequence:CCGGCAAATCAAATGTGGTGAACAACTCGAGTTGTTCACCACATTTGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-53s1c1
Sequence:CCGGGCTCTGAAGAACTACATCATACTCGAGTATGATGTAGTTCTTCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065555.3-553s1c1
Sequence:CCGGCTCAAACTATCCTGCAATAATCTCGAGATTATTGCAGGATAGTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)