EMAIL THIS PAGE TO A FRIEND

OR9G1

olfactory receptor, family 9, subfamily G, member 1

15 Gene Product Result for
Synonyms: OR9G5
UniProtKB ID: Q8NH87, Q6IEU9, Q8NGQ0
Gene ID:
Human(390174) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483510) cOR9G1 olfactory receptor family 9 subfamily G-like
cow(530966) olfactory receptor, family 9, subfamily G, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501701 Anti-OR9G1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005213 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222646 predicted 417
2 SASI_Hs01_00222648 predicted 431
3 SASI_Hs01_00222649 predicted 637
4 SASI_Hs01_00222650 predicted 424
5 SASI_Hs01_00222651 predicted 423
6 SASI_Hs02_00304784 predicted 313
7 SASI_Hs02_00304785 predicted 589
8 SASI_Hs01_00222652 predicted 415
9 SASI_Hs01_00222653 predicted 430
10 SASI_Hs01_00222654 predicted 413
11 SASI_Hs01_00222647 predicted 200
12 SASI_Hs01_00222655 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372403
OR9G1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 9, subfamily G, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-197s1c1
Sequence:CCGGCGTTTCTGGATCTCTGGTATTCTCGAGAATACCAGAGATCCAGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-729s1c1
Sequence:CCGGCCTGACCTCTGTCACTTTATACTCGAGTATAAAGTGACAGAGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-129s1c1
Sequence:CCGGCCTCATCGTGTTGATCTGTAACTCGAGTTACAGATCAACACGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372403
OR9G1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 9, subfamily G, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000203933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-197s1c1
Sequence:CCGGCGTTTCTGGATCTCTGGTATTCTCGAGAATACCAGAGATCCAGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-729s1c1
Sequence:CCGGCCTGACCTCTGTCACTTTATACTCGAGTATAAAGTGACAGAGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-129s1c1
Sequence:CCGGCCTCATCGTGTTGATCTGTAACTCGAGTTACAGATCAACACGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372403
OR9G1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 9, subfamily G, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000203933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-197s1c1
Sequence:CCGGCGTTTCTGGATCTCTGGTATTCTCGAGAATACCAGAGATCCAGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-729s1c1
Sequence:CCGGCCTGACCTCTGTCACTTTATACTCGAGTATAAAGTGACAGAGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372403.1-129s1c1
Sequence:CCGGCCTCATCGTGTTGATCTGTAACTCGAGTTACAGATCAACACGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)