EMAIL THIS PAGE TO A FRIEND

ORAI1

ORAI calcium release-activated calcium modulator 1

109 Gene Product Result for
Synonyms: CRACM1 ORAT1 TMEM142A
UniProtKB ID: Q96D31, Q3MHV3, Q6DHX2, Q96BP7, Q96K71
Gene ID:
Human(84876) Summary: The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 1 (IDTICED1). [provided by RefSeq, Sep 2011]
Mouse(109305) ORAI calcium release-activated calcium modulator 1
Rat(304496) ORAI calcium release-activated calcium modulator 1
chicken(416845) ORAI calcium release-activated calcium modulator 1
dog(486261) ORAI calcium release-activated calcium modulator 1
cow(517688) ORAI calcium release-activated calcium modulator 1
domestic cat(101096922) ORAI calcium release-activated calcium modulator 1
domestic guinea pig(100725803) ORAI calcium release-activated calcium modulator 1
naked mole-rat(101699660) ORAI calcium release-activated calcium modulator 1
sheep(101102013) ORAI calcium release-activated calcium modulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T182 Tyrphostin A9 solid human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032790 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120081 MISSION® esiRNA esiRNA human ORAI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032790 Rosetta Predictions human pricing
NM_001013982 Rosetta Predictions rat pricing
NM_175423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073221 predicted 585
2 SASI_Hs01_00073223 predicted 980
3 SASI_Hs01_00073224 predicted 1248
4 SASI_Hs01_00073226 predicted 1084
5 SASI_Hs02_00360350 predicted 1239
6 SASI_Hs01_00073228 predicted 1014
7 SASI_Hs01_00073229 predicted 592
8 SASI_Hs01_00073230 predicted 640
9 SASI_Hs02_00360351 predicted 1080
10 SASI_Hs02_00360352 predicted 910
11 SASI_Hs01_00073222 predicted 1243
12 SASI_Hs01_00073225 predicted 715
13 SASI_Hs01_00073227 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096791 predicted 673
2 SASI_Rn01_00096792 predicted 434
3 SASI_Rn01_00096794 predicted 481
4 SASI_Rn01_00096795 predicted 872
5 SASI_Rn02_00201332 predicted 246
6 SASI_Rn01_00096796 predicted 846
7 SASI_Rn02_00201333 predicted 438
8 SASI_Rn01_00096799 predicted 626
9 SASI_Rn01_00096800 predicted 254
10 SASI_Rn02_00201334 predicted 864
11 SASI_Rn01_00096793 predicted 512
12 SASI_Rn01_00096797 predicted 670
13 SASI_Rn01_00096798 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042894 predicted 774
2 SASI_Mm02_00346297 predicted 549
3 SASI_Mm01_00042896 predicted 813
4 SASI_Mm01_00042897 predicted 819
5 SASI_Mm01_00042898 predicted 653
6 SASI_Mm01_00042899 predicted 978
7 SASI_Mm01_00042900 predicted 775
8 SASI_Mm02_00346298 predicted 499
9 SASI_Mm01_00042901 predicted 590
10 SASI_Mm01_00042902 predicted 359
11 SASI_Mm01_00042895 predicted 999
12 SASI_Mm01_00042903 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175423
VALIDATED
ORAI1 MISSION shRNA Bacterial Glycerol Stock
ORAI calcium release-activated calcium modulator 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-839s1c1
Sequence:CCGGTGAATCAGTCATCGTCGCCAACTCGAGTTGGCGACGATGACTGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-539s21c1
Sequence:CCGGCCAGGGTTGCTCATCGTCTTTCTCGAGAAAGACGATGAGCAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175423.2-1214s1c1
Sequence:CCGGGAGTGTGGAAGGAAGAGGTTTCTCGAGAAACCTCTTCCTTCCACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-362s1c1
Sequence:CCGGCCAGAGTTACTCCGAGGTGATCTCGAGATCACCTCGGAGTAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-540s1c1
Sequence:CCGGCCAGGGTTGCTCATCGTCTTTCTCGAGAAAGACGATGAGCAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175423.2-654s1c1
Sequence:CCGGCACAACCTCAACTCGGTCAAACTCGAGTTTGACCGAGTTGAGGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175423.3-1546s21c1
Sequence:CCGGCACACTTGTATGTACACATAACTCGAGTTATGTGTACATACAAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-1011s21c1
Sequence:CCGGTCAATGAGCTGGCCGAGTTTGCTCGAGCAAACTCGGCCAGCTCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-653s21c1
Sequence:CCGGCACAACCTCAACTCGGTCAAACTCGAGTTTGACCGAGTTGAGGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175423.3-1121s21c1
Sequence:CCGGCTTTGAGGCCTTGGCCTTATGCTCGAGCATAAGGCCAAGGCCTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-771s21c1
Sequence:CCGGTCTGCTGGGTCAAGTTCTTACCTCGAGGTAAGAACTTGACCCAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175423
VALIDATED
ORAI1 MISSION shRNA shRNA Plasmid DNA
ORAI calcium release-activated calcium modulator 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-839s1c1
Sequence:CCGGTGAATCAGTCATCGTCGCCAACTCGAGTTGGCGACGATGACTGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-539s21c1
Sequence:CCGGCCAGGGTTGCTCATCGTCTTTCTCGAGAAAGACGATGAGCAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175423.2-1214s1c1
Sequence:CCGGGAGTGTGGAAGGAAGAGGTTTCTCGAGAAACCTCTTCCTTCCACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-362s1c1
Sequence:CCGGCCAGAGTTACTCCGAGGTGATCTCGAGATCACCTCGGAGTAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-540s1c1
Sequence:CCGGCCAGGGTTGCTCATCGTCTTTCTCGAGAAAGACGATGAGCAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175423.2-654s1c1
Sequence:CCGGCACAACCTCAACTCGGTCAAACTCGAGTTTGACCGAGTTGAGGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175423.3-1546s21c1
Sequence:CCGGCACACTTGTATGTACACATAACTCGAGTTATGTGTACATACAAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-1011s21c1
Sequence:CCGGTCAATGAGCTGGCCGAGTTTGCTCGAGCAAACTCGGCCAGCTCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-653s21c1
Sequence:CCGGCACAACCTCAACTCGGTCAAACTCGAGTTTGACCGAGTTGAGGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175423.3-1121s21c1
Sequence:CCGGCTTTGAGGCCTTGGCCTTATGCTCGAGCATAAGGCCAAGGCCTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-771s21c1
Sequence:CCGGTCTGCTGGGTCAAGTTCTTACCTCGAGGTAAGAACTTGACCCAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175423
VALIDATED
ORAI1 MISSION shRNA Lentiviral Transduction Particles
ORAI calcium release-activated calcium modulator 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-839s1c1
Sequence:CCGGTGAATCAGTCATCGTCGCCAACTCGAGTTGGCGACGATGACTGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-539s21c1
Sequence:CCGGCCAGGGTTGCTCATCGTCTTTCTCGAGAAAGACGATGAGCAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175423.2-1214s1c1
Sequence:CCGGGAGTGTGGAAGGAAGAGGTTTCTCGAGAAACCTCTTCCTTCCACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-362s1c1
Sequence:CCGGCCAGAGTTACTCCGAGGTGATCTCGAGATCACCTCGGAGTAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175423.2-540s1c1
Sequence:CCGGCCAGGGTTGCTCATCGTCTTTCTCGAGAAAGACGATGAGCAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175423.2-654s1c1
Sequence:CCGGCACAACCTCAACTCGGTCAAACTCGAGTTTGACCGAGTTGAGGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175423.3-1546s21c1
Sequence:CCGGCACACTTGTATGTACACATAACTCGAGTTATGTGTACATACAAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-1011s21c1
Sequence:CCGGTCAATGAGCTGGCCGAGTTTGCTCGAGCAAACTCGGCCAGCTCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-653s21c1
Sequence:CCGGCACAACCTCAACTCGGTCAAACTCGAGTTTGACCGAGTTGAGGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175423.3-1121s21c1
Sequence:CCGGCTTTGAGGCCTTGGCCTTATGCTCGAGCATAAGGCCAAGGCCTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175423.3-771s21c1
Sequence:CCGGTCTGCTGGGTCAAGTTCTTACCTCGAGGTAAGAACTTGACCCAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032790
ORAI1 MISSION shRNA Bacterial Glycerol Stock
ORAI calcium release-activated calcium modulator 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-367s21c1
Sequence:CCGGGAGTTACTCCGAGGTGATGAGCTCGAGCTCATCACCTCGGAGTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032790.2-1240s1c1
Sequence:CCGGGAAACTGTCCTCTAAGAGAATCTCGAGATTCTCTTAGAGGACAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032790.2-628s1c1
Sequence:CCGGGCAACGTGCACAATCTCAACTCTCGAGAGTTGAGATTGTGCACGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-646s21c1
Sequence:CCGGGAGCAACGTGCACAATCTCAACTCGAGTTGAGATTGTGCACGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-592s21c1
Sequence:CCGGGCACCTGTTTGCGCTCATGATCTCGAGATCATGAGCGCAAACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032790
ORAI1 MISSION shRNA shRNA Plasmid DNA
ORAI calcium release-activated calcium modulator 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-367s21c1
Sequence:CCGGGAGTTACTCCGAGGTGATGAGCTCGAGCTCATCACCTCGGAGTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032790.2-1240s1c1
Sequence:CCGGGAAACTGTCCTCTAAGAGAATCTCGAGATTCTCTTAGAGGACAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032790.2-628s1c1
Sequence:CCGGGCAACGTGCACAATCTCAACTCTCGAGAGTTGAGATTGTGCACGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-646s21c1
Sequence:CCGGGAGCAACGTGCACAATCTCAACTCGAGTTGAGATTGTGCACGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-592s21c1
Sequence:CCGGGCACCTGTTTGCGCTCATGATCTCGAGATCATGAGCGCAAACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032790
ORAI1 MISSION shRNA Lentiviral Transduction Particles
ORAI calcium release-activated calcium modulator 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-367s21c1
Sequence:CCGGGAGTTACTCCGAGGTGATGAGCTCGAGCTCATCACCTCGGAGTAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032790.2-1240s1c1
Sequence:CCGGGAAACTGTCCTCTAAGAGAATCTCGAGATTCTCTTAGAGGACAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032790.2-628s1c1
Sequence:CCGGGCAACGTGCACAATCTCAACTCTCGAGAGTTGAGATTGTGCACGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-646s21c1
Sequence:CCGGGAGCAACGTGCACAATCTCAACTCGAGTTGAGATTGTGCACGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032790.3-592s21c1
Sequence:CCGGGCACCTGTTTGCGCTCATGATCTCGAGATCATGAGCGCAAACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)