EMAIL THIS PAGE TO A FRIEND

ORAI3

ORAI calcium release-activated calcium modulator 3

54 Gene Product Result for
Synonyms: TMEM142C
UniProtKB ID: Q9BRQ5, Q96BI8
Gene ID:
Mouse(269999) ORAI calcium release-activated calcium modulator 3
Rat(309000) ORAI calcium release-activated calcium modulator 3
sheep(101105211) ORAI calcium release-activated calcium modulator 3
domestic guinea pig(100715641) ORAI calcium release-activated calcium modulator 3
naked mole-rat(101705579) ORAI calcium release-activated calcium modulator 3
dog(607303) ORAI calcium release-activated calcium modulator 3
domestic cat(101091330) ORAI calcium release-activated calcium modulator 3
cow(515971) ORAI calcium release-activated calcium modulator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152288 Rosetta Predictions human pricing
NM_001014024 Rosetta Predictions rat pricing
NM_198424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365843 predicted 695
2 SASI_Hs01_00158754 predicted 1186
3 SASI_Hs01_00158755 predicted 1018
4 SASI_Hs01_00158756 predicted 1197
5 SASI_Hs01_00158757 predicted 585
6 SASI_Hs01_00158758 predicted 800
7 SASI_Hs01_00158760 predicted 800
8 SASI_Hs01_00158762 predicted 1065
9 SASI_Hs01_00158763 predicted 1077
10 SASI_Hs02_00365844 predicted 1068
11 SASI_Hs01_00158759 predicted 1030
12 SASI_Hs01_00158761 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104741 predicted 326
2 SASI_Rn01_00104742 predicted 1261
3 SASI_Rn01_00104743 predicted 1078
4 SASI_Rn01_00104745 predicted 742
5 SASI_Rn01_00104746 predicted 898
6 SASI_Rn01_00104747 predicted 868
7 SASI_Rn01_00104748 predicted 565
8 SASI_Rn01_00104749 predicted 486
9 SASI_Rn01_00104750 predicted 887
10 SASI_Rn02_00201408 predicted 1275
11 SASI_Rn01_00104744 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054646 predicted 786
2 SASI_Mm01_00054647 predicted 1186
3 SASI_Mm01_00054648 predicted 764
4 SASI_Mm01_00054649 predicted 930
5 SASI_Mm01_00054650 predicted 922
6 SASI_Mm01_00054651 predicted 850
7 SASI_Mm01_00054652 predicted 884
8 SASI_Mm01_00054653 predicted 909
9 SASI_Mm01_00054654 predicted 1358
10 SASI_Mm01_00054655 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152288
VALIDATED
ORAI3 MISSION shRNA Bacterial Glycerol Stock
ORAI calcium release-activated calcium modulator 3
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-983s21c1
Sequence:CCGGTGTGGCCTTTGCCCTGCATTTCTCGAGAAATGCAGGGCAAAGGCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-709s21c1
Sequence:CCGGTGGTTGGTTGGGTCAAGTTTGCTCGAGCAAACTTGACCCAACCAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152288.2-1396s21c1
Sequence:CCGGGGGACCTTCAGTGCTGACTTTCTCGAGAAAGTCAGCACTGAAGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1407s1c1
Sequence:CCGGGCCACCATTTCCATTCCTATACTCGAGTATAGGAATGGAAATGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-1033s1c1
Sequence:CCGGCAGGAACTAGAGGAACTGAATCTCGAGATTCAGTTCCTCTAGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-561s1c1
Sequence:CCGGCATTGAAGCTGTGAGCAACATCTCGAGATGTTGCTCACAGCTTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-558s1c1
Sequence:CCGGCCACATTGAAGCTGTGAGCAACTCGAGTTGCTCACAGCTTCAATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-573s1c1
Sequence:CCGGGAGCAACATCCACAACCTCAACTCGAGTTGAGGTTGTGGATGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-579s1c1
Sequence:CCGGCATCCACAACCTCAACTCTGTCTCGAGACAGAGTTGAGGTTGTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-1032s1c1
Sequence:CCGGGCAGGAACTAGAGGAACTGAACTCGAGTTCAGTTCCTCTAGTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-804s1c1
Sequence:CCGGCCTTAGTCCAGCTTCCAATCTCTCGAGAGATTGGAAGCTGGACTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-682s1c1
Sequence:CCGGCTTGCTGAAGTTGTCCTGGTTCTCGAGAACCAGGACAACTTCAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-1718s1c1
Sequence:CCGGGCTGGGATTCCTTTCTTTATTCTCGAGAATAAAGAAAGGAATCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-530s21c1
Sequence:CCGGGCACCTCTTTGCACTCATGGTCTCGAGACCATGAGTGCAAAGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-996s21c1
Sequence:CCGGCTGCATTTCTACCGCTCCTTGCTCGAGCAAGGAGCGGTAGAAATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-669s1c1
Sequence:CCGGCACCTTTCTCTTCCTTGCTGACTCGAGTCAGCAAGGAAGAGAAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1837s1c1
Sequence:CCGGCCAAGGCATTGGTCTAGCTTTCTCGAGAAAGCTAGACCAATGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1448s1c1
Sequence:CCGGGCAGCCAATTGTTGGTTTAATCTCGAGATTAAACCAACAATTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-1023s21c1
Sequence:CCGGCACAAGACAGACCGCTACAAGCTCGAGCTTGTAGCGGTCTGTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152288
VALIDATED
ORAI3 MISSION shRNA shRNA Plasmid DNA
ORAI calcium release-activated calcium modulator 3
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-983s21c1
Sequence:CCGGTGTGGCCTTTGCCCTGCATTTCTCGAGAAATGCAGGGCAAAGGCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-709s21c1
Sequence:CCGGTGGTTGGTTGGGTCAAGTTTGCTCGAGCAAACTTGACCCAACCAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152288.2-1396s21c1
Sequence:CCGGGGGACCTTCAGTGCTGACTTTCTCGAGAAAGTCAGCACTGAAGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1407s1c1
Sequence:CCGGGCCACCATTTCCATTCCTATACTCGAGTATAGGAATGGAAATGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-1033s1c1
Sequence:CCGGCAGGAACTAGAGGAACTGAATCTCGAGATTCAGTTCCTCTAGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-561s1c1
Sequence:CCGGCATTGAAGCTGTGAGCAACATCTCGAGATGTTGCTCACAGCTTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-558s1c1
Sequence:CCGGCCACATTGAAGCTGTGAGCAACTCGAGTTGCTCACAGCTTCAATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-573s1c1
Sequence:CCGGGAGCAACATCCACAACCTCAACTCGAGTTGAGGTTGTGGATGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-579s1c1
Sequence:CCGGCATCCACAACCTCAACTCTGTCTCGAGACAGAGTTGAGGTTGTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-1032s1c1
Sequence:CCGGGCAGGAACTAGAGGAACTGAACTCGAGTTCAGTTCCTCTAGTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-804s1c1
Sequence:CCGGCCTTAGTCCAGCTTCCAATCTCTCGAGAGATTGGAAGCTGGACTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-682s1c1
Sequence:CCGGCTTGCTGAAGTTGTCCTGGTTCTCGAGAACCAGGACAACTTCAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-1718s1c1
Sequence:CCGGGCTGGGATTCCTTTCTTTATTCTCGAGAATAAAGAAAGGAATCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-530s21c1
Sequence:CCGGGCACCTCTTTGCACTCATGGTCTCGAGACCATGAGTGCAAAGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-996s21c1
Sequence:CCGGCTGCATTTCTACCGCTCCTTGCTCGAGCAAGGAGCGGTAGAAATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-669s1c1
Sequence:CCGGCACCTTTCTCTTCCTTGCTGACTCGAGTCAGCAAGGAAGAGAAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1837s1c1
Sequence:CCGGCCAAGGCATTGGTCTAGCTTTCTCGAGAAAGCTAGACCAATGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1448s1c1
Sequence:CCGGGCAGCCAATTGTTGGTTTAATCTCGAGATTAAACCAACAATTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-1023s21c1
Sequence:CCGGCACAAGACAGACCGCTACAAGCTCGAGCTTGTAGCGGTCTGTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152288
VALIDATED
ORAI3 MISSION shRNA Lentiviral Transduction Particles
ORAI calcium release-activated calcium modulator 3
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-983s21c1
Sequence:CCGGTGTGGCCTTTGCCCTGCATTTCTCGAGAAATGCAGGGCAAAGGCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-709s21c1
Sequence:CCGGTGGTTGGTTGGGTCAAGTTTGCTCGAGCAAACTTGACCCAACCAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152288.2-1396s21c1
Sequence:CCGGGGGACCTTCAGTGCTGACTTTCTCGAGAAAGTCAGCACTGAAGGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1407s1c1
Sequence:CCGGGCCACCATTTCCATTCCTATACTCGAGTATAGGAATGGAAATGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-1033s1c1
Sequence:CCGGCAGGAACTAGAGGAACTGAATCTCGAGATTCAGTTCCTCTAGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-561s1c1
Sequence:CCGGCATTGAAGCTGTGAGCAACATCTCGAGATGTTGCTCACAGCTTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-558s1c1
Sequence:CCGGCCACATTGAAGCTGTGAGCAACTCGAGTTGCTCACAGCTTCAATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152288.1-573s1c1
Sequence:CCGGGAGCAACATCCACAACCTCAACTCGAGTTGAGGTTGTGGATGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-579s1c1
Sequence:CCGGCATCCACAACCTCAACTCTGTCTCGAGACAGAGTTGAGGTTGTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-1032s1c1
Sequence:CCGGGCAGGAACTAGAGGAACTGAACTCGAGTTCAGTTCCTCTAGTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-804s1c1
Sequence:CCGGCCTTAGTCCAGCTTCCAATCTCTCGAGAGATTGGAAGCTGGACTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-682s1c1
Sequence:CCGGCTTGCTGAAGTTGTCCTGGTTCTCGAGAACCAGGACAACTTCAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-1718s1c1
Sequence:CCGGGCTGGGATTCCTTTCTTTATTCTCGAGAATAAAGAAAGGAATCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-530s21c1
Sequence:CCGGGCACCTCTTTGCACTCATGGTCTCGAGACCATGAGTGCAAAGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-996s21c1
Sequence:CCGGCTGCATTTCTACCGCTCCTTGCTCGAGCAAGGAGCGGTAGAAATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152288.1-669s1c1
Sequence:CCGGCACCTTTCTCTTCCTTGCTGACTCGAGTCAGCAAGGAAGAGAAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1837s1c1
Sequence:CCGGCCAAGGCATTGGTCTAGCTTTCTCGAGAAAGCTAGACCAATGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152288.1-1448s1c1
Sequence:CCGGGCAGCCAATTGTTGGTTTAATCTCGAGATTAAACCAACAATTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152288.2-1023s21c1
Sequence:CCGGCACAAGACAGACCGCTACAAGCTCGAGCTTGTAGCGGTCTGTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198424
VALIDATED
ORAI3 MISSION shRNA Bacterial Glycerol Stock
ORAI calcium release-activated calcium modulator 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-823s1c1
Sequence:CCGGCAAGTGTGTGATAGTGCTCATCTCGAGATGAGCACTATCACACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-393s1c1
Sequence:CCGGGCTGGAGAACGATCATGAATACTCGAGTATTCATGATCGTTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-507s1c1
Sequence:CCGGCCATATTGAAGCCGTGAGCAACTCGAGTTGCTCACGGCTTCAATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-795s21c1
Sequence:CCGGACCATCCTCTGCTTCTATTACCTCGAGGTAATAGAAGCAGAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-769s21c1
Sequence:CCGGTCCCTTAGTTTAGCTTCTAACCTCGAGGTTAGAAGCTAAACTAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-936s21c1
Sequence:CCGGTATGGCCTTTGCCCTACATTTCTCGAGAAATGTAGGGCAAAGGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-592s21c1
Sequence:CCGGCACCAACGACTGCACAGATACCTCGAGGTATCTGTGCAGTCGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.3-794s1c1
Sequence:CCGGCACCATCCTCTGCTTCTATTACTCGAGTAATAGAAGCAGAGGATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-1257s21c1
Sequence:CCGGCCTAAGGATCCTGGGTTAAATCTCGAGATTTAACCCAGGATCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198424.3-1385s1c1
Sequence:CCGGGCCCTTGCTTATCTGTATAATCTCGAGATTATACAGATAAGCAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198424
VALIDATED
ORAI3 MISSION shRNA shRNA Plasmid DNA
ORAI calcium release-activated calcium modulator 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-823s1c1
Sequence:CCGGCAAGTGTGTGATAGTGCTCATCTCGAGATGAGCACTATCACACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-393s1c1
Sequence:CCGGGCTGGAGAACGATCATGAATACTCGAGTATTCATGATCGTTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-507s1c1
Sequence:CCGGCCATATTGAAGCCGTGAGCAACTCGAGTTGCTCACGGCTTCAATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-795s21c1
Sequence:CCGGACCATCCTCTGCTTCTATTACCTCGAGGTAATAGAAGCAGAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-769s21c1
Sequence:CCGGTCCCTTAGTTTAGCTTCTAACCTCGAGGTTAGAAGCTAAACTAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-936s21c1
Sequence:CCGGTATGGCCTTTGCCCTACATTTCTCGAGAAATGTAGGGCAAAGGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-592s21c1
Sequence:CCGGCACCAACGACTGCACAGATACCTCGAGGTATCTGTGCAGTCGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.3-794s1c1
Sequence:CCGGCACCATCCTCTGCTTCTATTACTCGAGTAATAGAAGCAGAGGATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-1257s21c1
Sequence:CCGGCCTAAGGATCCTGGGTTAAATCTCGAGATTTAACCCAGGATCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198424.3-1385s1c1
Sequence:CCGGGCCCTTGCTTATCTGTATAATCTCGAGATTATACAGATAAGCAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198424
VALIDATED
ORAI3 MISSION shRNA Lentiviral Transduction Particles
ORAI calcium release-activated calcium modulator 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-823s1c1
Sequence:CCGGCAAGTGTGTGATAGTGCTCATCTCGAGATGAGCACTATCACACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-393s1c1
Sequence:CCGGGCTGGAGAACGATCATGAATACTCGAGTATTCATGATCGTTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.1-507s1c1
Sequence:CCGGCCATATTGAAGCCGTGAGCAACTCGAGTTGCTCACGGCTTCAATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-795s21c1
Sequence:CCGGACCATCCTCTGCTTCTATTACCTCGAGGTAATAGAAGCAGAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-769s21c1
Sequence:CCGGTCCCTTAGTTTAGCTTCTAACCTCGAGGTTAGAAGCTAAACTAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-936s21c1
Sequence:CCGGTATGGCCTTTGCCCTACATTTCTCGAGAAATGTAGGGCAAAGGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-592s21c1
Sequence:CCGGCACCAACGACTGCACAGATACCTCGAGGTATCTGTGCAGTCGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198424.3-794s1c1
Sequence:CCGGCACCATCCTCTGCTTCTATTACTCGAGTAATAGAAGCAGAGGATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198424.3-1257s21c1
Sequence:CCGGCCTAAGGATCCTGGGTTAAATCTCGAGATTTAACCCAGGATCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198424.3-1385s1c1
Sequence:CCGGGCCCTTGCTTATCTGTATAATCTCGAGATTATACAGATAAGCAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)