EMAIL THIS PAGE TO A FRIEND

ORC1

origin recognition complex, subunit 1

68 Gene Product Result for
Synonyms: HSORC1 ORC1L PARC1
UniProtKB ID: Q13415, D3DQ34, Q13471, Q5T0F5
Gene ID:
Human(4998) Summary: The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(18392) origin recognition complex, subunit 1
Rat(313479) origin recognition complex, subunit 1
fruit fly(35686) Origin recognition complex subunit 1
chicken(424640) origin recognition complex, subunit 1
dog(475351) origin recognition complex, subunit 1
domestic cat(101090883) origin recognition complex, subunit 1
cow(513523) origin recognition complex, subunit 1
Zebrafish(554509) origin recognition complex, subunit 1
sheep(101115076) origin recognition complex, subunit 1
domestic guinea pig(100724157) origin recognition complex, subunit 1
naked mole-rat(101713340) origin recognition complex, subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004153 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004153 Rosetta Predictions human pricing
NM_177931 Rosetta Predictions rat pricing
NM_001014425 Rosetta Predictions mouse pricing
NM_011015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038886 predicted 1369
2 SASI_Hs01_00038887 predicted 1178
3 SASI_Hs01_00038888 predicted 2502
4 SASI_Hs01_00038889 predicted 542
5 SASI_Hs01_00038890 predicted 2224
6 SASI_Hs02_00337003 predicted 1724
7 SASI_Hs01_00038891 predicted 2121
8 SASI_Hs01_00038893 predicted 2596
9 SASI_Hs01_00038894 predicted 1482
10 SASI_Hs02_00337004 predicted 1151
11 SASI_Hs01_00038885 predicted 1024
12 SASI_Hs01_00038892 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269594 predicted 654
2 SASI_Rn01_00073226 predicted 336
3 SASI_Rn01_00073227 predicted 1106
4 SASI_Rn02_00269595 predicted 1846
5 SASI_Rn01_00073229 predicted 741
6 SASI_Rn01_00073230 predicted 927
7 SASI_Rn01_00073232 predicted 618
8 SASI_Rn01_00073233 predicted 1388
9 SASI_Rn01_00073234 predicted 1058
10 SASI_Rn01_00073235 predicted 1120
11 SASI_Rn01_00073228 predicted 1125
12 SASI_Rn01_00073231 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170326 predicted 979
2 SASI_Mm01_00170327 predicted 1038
3 SASI_Mm01_00170328 predicted 1038
4 SASI_Mm01_00170329 predicted 1672
5 SASI_Mm01_00170330 predicted 504
6 SASI_Mm01_00170331 predicted 462
7 SASI_Mm01_00170332 predicted 1621
8 SASI_Mm01_00170333 predicted 415
9 SASI_Mm01_00170334 predicted 234
10 SASI_Mm01_00170335 predicted 2035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319735 predicted 2707
2 SASI_Mm02_00319736 predicted 318
3 SASI_Mm01_00189290 predicted 1275
4 SASI_Mm02_00319737 predicted 965
5 SASI_Mm01_00189292 predicted 1904
6 SASI_Mm01_00189293 predicted 631
7 SASI_Mm02_00319738 predicted 2445
8 SASI_Mm01_00189294 predicted 593
9 SASI_Mm02_00319739 predicted 664
10 SASI_Mm01_00189295 predicted 1859
11 SASI_Mm01_00189289 predicted 1208
12 SASI_Mm01_00189291 predicted 1259
13 SASI_Mm01_00189296 predicted 542
14 SASI_Mm01_00189297 predicted 362
15 SASI_Mm01_00189298 predicted 2272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011015
VALIDATED
ORC1 MISSION shRNA Bacterial Glycerol Stock
origin recognition complex, subunit 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-869s21c1
Sequence:CCGGCCTAACACGAGGTGGTCAAAGCTCGAGCTTTGACCACCTCGTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-1758s21c1
Sequence:CCGGTTCAATATGTTGAGGTTAATGCTCGAGCATTAACCTCAACATATTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011015.2-2806s21c1
Sequence:CCGGTACGGTAACATACTATGTATACTCGAGTATACATAGTATGTTACCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-792s21c1
Sequence:CCGGACCAGACTCCTGCTAATATTGCTCGAGCAATATTAGCAGGAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-1266s21c1
Sequence:CCGGTCTTGACTTTGAAGCGGATTACTCGAGTAATCCGCTTCAAAGTCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-324s21c1
Sequence:CCGGTGGCTAAACTGATTGAATTATCTCGAGATAATTCAATCAGTTTAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-2675s21c1
Sequence:CCGGGCTTTGTCTCAGAGCTTTATTCTCGAGAATAAAGCTCTGAGACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011015.1-2712s1c1
Sequence:CCGGGCAGAATATACAGGATGGAAACTCGAGTTTCCATCCTGTATATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-2305s1c1
Sequence:CCGGGCCCACTTAATGGAAGCTATACTCGAGTATAGCTTCCATTAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-963s1c1
Sequence:CCGGGCCTAATAAACCTCGTGAAATCTCGAGATTTCACGAGGTTTATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-2140s1c1
Sequence:CCGGCTGAGGAATTTAAGGGCCTTTCTCGAGAAAGGCCCTTAAATTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-445s1c1
Sequence:CCGGGCACAGGAGATATTCTGGTATCTCGAGATACCAGAATATCTCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011015
VALIDATED
ORC1 MISSION shRNA shRNA Plasmid DNA
origin recognition complex, subunit 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-869s21c1
Sequence:CCGGCCTAACACGAGGTGGTCAAAGCTCGAGCTTTGACCACCTCGTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-1758s21c1
Sequence:CCGGTTCAATATGTTGAGGTTAATGCTCGAGCATTAACCTCAACATATTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011015.2-2806s21c1
Sequence:CCGGTACGGTAACATACTATGTATACTCGAGTATACATAGTATGTTACCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-792s21c1
Sequence:CCGGACCAGACTCCTGCTAATATTGCTCGAGCAATATTAGCAGGAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-1266s21c1
Sequence:CCGGTCTTGACTTTGAAGCGGATTACTCGAGTAATCCGCTTCAAAGTCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-324s21c1
Sequence:CCGGTGGCTAAACTGATTGAATTATCTCGAGATAATTCAATCAGTTTAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-2675s21c1
Sequence:CCGGGCTTTGTCTCAGAGCTTTATTCTCGAGAATAAAGCTCTGAGACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011015.1-2712s1c1
Sequence:CCGGGCAGAATATACAGGATGGAAACTCGAGTTTCCATCCTGTATATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-2305s1c1
Sequence:CCGGGCCCACTTAATGGAAGCTATACTCGAGTATAGCTTCCATTAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-963s1c1
Sequence:CCGGGCCTAATAAACCTCGTGAAATCTCGAGATTTCACGAGGTTTATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-2140s1c1
Sequence:CCGGCTGAGGAATTTAAGGGCCTTTCTCGAGAAAGGCCCTTAAATTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-445s1c1
Sequence:CCGGGCACAGGAGATATTCTGGTATCTCGAGATACCAGAATATCTCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011015
VALIDATED
ORC1 MISSION shRNA Lentiviral Transduction Particles
origin recognition complex, subunit 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-869s21c1
Sequence:CCGGCCTAACACGAGGTGGTCAAAGCTCGAGCTTTGACCACCTCGTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-1758s21c1
Sequence:CCGGTTCAATATGTTGAGGTTAATGCTCGAGCATTAACCTCAACATATTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011015.2-2806s21c1
Sequence:CCGGTACGGTAACATACTATGTATACTCGAGTATACATAGTATGTTACCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-792s21c1
Sequence:CCGGACCAGACTCCTGCTAATATTGCTCGAGCAATATTAGCAGGAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011015.2-1266s21c1
Sequence:CCGGTCTTGACTTTGAAGCGGATTACTCGAGTAATCCGCTTCAAAGTCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-324s21c1
Sequence:CCGGTGGCTAAACTGATTGAATTATCTCGAGATAATTCAATCAGTTTAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011015.2-2675s21c1
Sequence:CCGGGCTTTGTCTCAGAGCTTTATTCTCGAGAATAAAGCTCTGAGACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011015.1-2712s1c1
Sequence:CCGGGCAGAATATACAGGATGGAAACTCGAGTTTCCATCCTGTATATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-2305s1c1
Sequence:CCGGGCCCACTTAATGGAAGCTATACTCGAGTATAGCTTCCATTAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-963s1c1
Sequence:CCGGGCCTAATAAACCTCGTGAAATCTCGAGATTTCACGAGGTTTATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-2140s1c1
Sequence:CCGGCTGAGGAATTTAAGGGCCTTTCTCGAGAAAGGCCCTTAAATTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011015.1-445s1c1
Sequence:CCGGGCACAGGAGATATTCTGGTATCTCGAGATACCAGAATATCTCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004153
VALIDATED
ORC1 MISSION shRNA Bacterial Glycerol Stock
origin recognition complex, subunit 1
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-355s21c1
Sequence:CCGGCACATCCAGATTGGACAGTTTCTCGAGAAACTGTCCAATCTGGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-1947s21c1
Sequence:CCGGCCACCAAGTCTATGTGCAAATCTCGAGATTTGCACATAGACTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-2596s21c1
Sequence:CCGGGCCACGTTTCAACAGATATATCTCGAGATATATCTGTTGAAACGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-2193s21c1
Sequence:CCGGGCCAGAGCGAATCATGATGAACTCGAGTTCATCATGATTCGCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-938s21c1
Sequence:CCGGGCAACTTAGGTAACCCTCAGACTCGAGTCTGAGGGTTACCTAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004153.2-739s1c1
Sequence:CCGGGCGGAGTTGAATAAACCACAACTCGAGTTGTGGTTTATTCAACTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-1947s1c1
Sequence:CCGGCCACCAAGTCTATGTGCAAATCTCGAGATTTGCACATAGACTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-355s1c1
Sequence:CCGGCACATCCAGATTGGACAGTTTCTCGAGAAACTGTCCAATCTGGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-726s1c1
Sequence:CCGGCTCAGAACTATTTGCGGAGTTCTCGAGAACTCCGCAAATAGTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-1774s1c1
Sequence:CCGGGAAAGCAAACTCCTTGACCATCTCGAGATGGTCAAGGAGTTTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-938s1c1
Sequence:CCGGGCAACTTAGGTAACCCTCAGACTCGAGTCTGAGGGTTACCTAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-2193s1c1
Sequence:CCGGGCCAGAGCGAATCATGATGAACTCGAGTTCATCATGATTCGCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004153.2-2166s1c1
Sequence:CCGGCCTGGCAATTGCCAACACAATCTCGAGATTGTGTTGGCAATTGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-598s1c1
Sequence:CCGGGAGACCATCATTGGCCTTGTTCTCGAGAACAAGGCCAATGATGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-334s1c1
Sequence:CCGGGAAGGTTGTTCCACCGAGATTCTCGAGAATCTCGGTGGAACAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-1147s1c1
Sequence:CCGGGCTTCACCTGAACATCGCATACTCGAGTATGCGATGTTCAGGTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-2298s1c1
Sequence:CCGGGCTCAAGCATCTAAAGGCCTTCTCGAGAAGGCCTTTAGATGCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-2596s1c1
Sequence:CCGGGCCACGTTTCAACAGATATATCTCGAGATATATCTGTTGAAACGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-1372s1c1
Sequence:CCGGGTCTTGACTATGAATCGGATTCTCGAGAATCCGATTCATAGTCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-1365s1c1
Sequence:CCGGGAGTTCTGTCTTGACTATGAACTCGAGTTCATAGTCAAGACAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004153
VALIDATED
ORC1 MISSION shRNA shRNA Plasmid DNA
origin recognition complex, subunit 1
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-355s21c1
Sequence:CCGGCACATCCAGATTGGACAGTTTCTCGAGAAACTGTCCAATCTGGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-1947s21c1
Sequence:CCGGCCACCAAGTCTATGTGCAAATCTCGAGATTTGCACATAGACTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-2596s21c1
Sequence:CCGGGCCACGTTTCAACAGATATATCTCGAGATATATCTGTTGAAACGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-2193s21c1
Sequence:CCGGGCCAGAGCGAATCATGATGAACTCGAGTTCATCATGATTCGCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-938s21c1
Sequence:CCGGGCAACTTAGGTAACCCTCAGACTCGAGTCTGAGGGTTACCTAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004153.2-739s1c1
Sequence:CCGGGCGGAGTTGAATAAACCACAACTCGAGTTGTGGTTTATTCAACTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-1947s1c1
Sequence:CCGGCCACCAAGTCTATGTGCAAATCTCGAGATTTGCACATAGACTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-355s1c1
Sequence:CCGGCACATCCAGATTGGACAGTTTCTCGAGAAACTGTCCAATCTGGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-726s1c1
Sequence:CCGGCTCAGAACTATTTGCGGAGTTCTCGAGAACTCCGCAAATAGTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-1774s1c1
Sequence:CCGGGAAAGCAAACTCCTTGACCATCTCGAGATGGTCAAGGAGTTTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-938s1c1
Sequence:CCGGGCAACTTAGGTAACCCTCAGACTCGAGTCTGAGGGTTACCTAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-2193s1c1
Sequence:CCGGGCCAGAGCGAATCATGATGAACTCGAGTTCATCATGATTCGCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004153.2-2166s1c1
Sequence:CCGGCCTGGCAATTGCCAACACAATCTCGAGATTGTGTTGGCAATTGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-598s1c1
Sequence:CCGGGAGACCATCATTGGCCTTGTTCTCGAGAACAAGGCCAATGATGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-334s1c1
Sequence:CCGGGAAGGTTGTTCCACCGAGATTCTCGAGAATCTCGGTGGAACAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-1147s1c1
Sequence:CCGGGCTTCACCTGAACATCGCATACTCGAGTATGCGATGTTCAGGTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-2298s1c1
Sequence:CCGGGCTCAAGCATCTAAAGGCCTTCTCGAGAAGGCCTTTAGATGCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-2596s1c1
Sequence:CCGGGCCACGTTTCAACAGATATATCTCGAGATATATCTGTTGAAACGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-1372s1c1
Sequence:CCGGGTCTTGACTATGAATCGGATTCTCGAGAATCCGATTCATAGTCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-1365s1c1
Sequence:CCGGGAGTTCTGTCTTGACTATGAACTCGAGTTCATAGTCAAGACAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004153
VALIDATED
ORC1 MISSION shRNA Lentiviral Transduction Particles
origin recognition complex, subunit 1
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-355s21c1
Sequence:CCGGCACATCCAGATTGGACAGTTTCTCGAGAAACTGTCCAATCTGGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-1947s21c1
Sequence:CCGGCCACCAAGTCTATGTGCAAATCTCGAGATTTGCACATAGACTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-2596s21c1
Sequence:CCGGGCCACGTTTCAACAGATATATCTCGAGATATATCTGTTGAAACGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-2193s21c1
Sequence:CCGGGCCAGAGCGAATCATGATGAACTCGAGTTCATCATGATTCGCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004153.2-938s21c1
Sequence:CCGGGCAACTTAGGTAACCCTCAGACTCGAGTCTGAGGGTTACCTAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004153.2-739s1c1
Sequence:CCGGGCGGAGTTGAATAAACCACAACTCGAGTTGTGGTTTATTCAACTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-1947s1c1
Sequence:CCGGCCACCAAGTCTATGTGCAAATCTCGAGATTTGCACATAGACTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-355s1c1
Sequence:CCGGCACATCCAGATTGGACAGTTTCTCGAGAAACTGTCCAATCTGGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-726s1c1
Sequence:CCGGCTCAGAACTATTTGCGGAGTTCTCGAGAACTCCGCAAATAGTTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-1774s1c1
Sequence:CCGGGAAAGCAAACTCCTTGACCATCTCGAGATGGTCAAGGAGTTTGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-938s1c1
Sequence:CCGGGCAACTTAGGTAACCCTCAGACTCGAGTCTGAGGGTTACCTAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-2193s1c1
Sequence:CCGGGCCAGAGCGAATCATGATGAACTCGAGTTCATCATGATTCGCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004153.2-2166s1c1
Sequence:CCGGCCTGGCAATTGCCAACACAATCTCGAGATTGTGTTGGCAATTGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-598s1c1
Sequence:CCGGGAGACCATCATTGGCCTTGTTCTCGAGAACAAGGCCAATGATGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-334s1c1
Sequence:CCGGGAAGGTTGTTCCACCGAGATTCTCGAGAATCTCGGTGGAACAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-1147s1c1
Sequence:CCGGGCTTCACCTGAACATCGCATACTCGAGTATGCGATGTTCAGGTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004153.2-2298s1c1
Sequence:CCGGGCTCAAGCATCTAAAGGCCTTCTCGAGAAGGCCTTTAGATGCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-2596s1c1
Sequence:CCGGGCCACGTTTCAACAGATATATCTCGAGATATATCTGTTGAAACGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004153.2-1372s1c1
Sequence:CCGGGTCTTGACTATGAATCGGATTCTCGAGAATCCGATTCATAGTCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004153.2-1365s1c1
Sequence:CCGGGAGTTCTGTCTTGACTATGAACTCGAGTTCATAGTCAAGACAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)