EMAIL THIS PAGE TO A FRIEND

ORC3

origin recognition complex, subunit 3

74 Gene Product Result for
Synonyms: LAT LATHEO ORC3L
Gene ID:
Human(23595) Summary: The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(50793) origin recognition complex, subunit 3
Rat(313138) origin recognition complex, subunit 3
sheep(101112489) origin recognition complex, subunit 3
domestic guinea pig(100727573) origin recognition complex, subunit 3
naked mole-rat(101700236) origin recognition complex, subunit 3
Thale Cress(831530) origin recognition complex subunit 3
cow(523714) origin recognition complex, subunit 3
Zebrafish(334315) origin recognition complex, subunit 3
chicken(421822) origin recognition complex, subunit 3
domestic cat(101090017) origin recognition complex, subunit 3
dog(474991) origin recognition complex, subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012381 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025791 MISSION® esiRNA esiRNA human ORC3L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012381 Rosetta Predictions human pricing
NM_181837 Rosetta Predictions human pricing
NM_001025282 Rosetta Predictions rat pricing
NM_015824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031648 predicted 362
2 SASI_Hs02_00344175 predicted 304
3 SASI_Hs01_00031649 predicted 1933
4 SASI_Hs02_00344176 predicted 244
5 SASI_Hs01_00031650 predicted 903
6 SASI_Hs01_00031651 predicted 723
7 SASI_Hs01_00031652 predicted 1341
8 SASI_Hs01_00031655 predicted 804
9 SASI_Hs01_00031656 predicted 1836
10 SASI_Hs02_00344177 predicted 1847
11 SASI_Hs01_00031653 predicted 451
12 SASI_Hs01_00031654 predicted 1067
13 SASI_Hs01_00031657 predicted 2069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116420 predicted 365
2 SASI_Hs02_00370425 predicted 305
3 SASI_Hs01_00116421 predicted 1937
4 SASI_Hs02_00370426 predicted 250
5 SASI_Hs01_00116422 predicted 900
6 SASI_Hs01_00116423 predicted 722
7 SASI_Hs01_00116424 predicted 1338
8 SASI_Hs01_00116427 predicted 802
9 SASI_Hs01_00116428 predicted 1834
10 SASI_Hs02_00370427 predicted 1851
11 SASI_Hs01_00116425 predicted 458
12 SASI_Hs01_00116426 predicted 1067
13 SASI_Hs01_00116429 predicted 2066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105874 predicted 332
2 SASI_Rn02_00203111 predicted 1205
3 SASI_Rn01_00105875 predicted 1799
4 SASI_Rn02_00203112 predicted 968
5 SASI_Rn01_00105876 predicted 1292
6 SASI_Rn01_00105877 predicted 1661
7 SASI_Rn01_00105878 predicted 907
8 SASI_Rn01_00105881 predicted 549
9 SASI_Rn01_00105882 predicted 1102
10 SASI_Rn02_00203113 predicted 1923
11 SASI_Rn01_00105873 predicted 1626
12 SASI_Rn01_00105879 predicted 545
13 SASI_Rn01_00105880 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085881 predicted 1295
2 SASI_Mm02_00323236 predicted 1258
3 SASI_Mm01_00085883 predicted 1362
4 SASI_Mm01_00085884 predicted 1852
5 SASI_Mm01_00085886 predicted 819
6 SASI_Mm01_00085887 predicted 2058
7 SASI_Mm02_00323237 predicted 961
8 SASI_Mm01_00085889 predicted 369
9 SASI_Mm01_00085890 predicted 1712
10 SASI_Mm02_00323238 predicted 840
11 SASI_Mm01_00085882 predicted 576
12 SASI_Mm01_00085885 predicted 1681
13 SASI_Mm01_00085888 predicted 1667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015824
VALIDATED
ORC3 MISSION shRNA Bacterial Glycerol Stock
origin recognition complex, subunit 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015824.4-3104s21c1
Sequence:CCGGCCTGGCACTTACTAGATATTTCTCGAGAAATATCTAGTAAGTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-1870s21c1
Sequence:CCGGCCATACTATTACCTGAAGAATCTCGAGATTCTTCAGGTAATAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-568s21c1
Sequence:CCGGGCCCTGAAGAAGACAAATTATCTCGAGATAATTTGTCTTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015824.2-571s1c1
Sequence:CCGGGCCCTGAAGAAGACAAATTATCTCGAGATAATTTGTCTTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-1266s1c1
Sequence:CCGGCCTGCATGTTTACCATATCAACTCGAGTTGATATGGTAAACATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-3107s1c1
Sequence:CCGGCCTGGCACTTACTAGATATTTCTCGAGAAATATCTAGTAAGTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-1873s1c1
Sequence:CCGGCCATACTATTACCTGAAGAATCTCGAGATTCTTCAGGTAATAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015824.2-2080s1c1
Sequence:CCGGGCTCGATTTATTCGAGCTGTTCTCGAGAACAGCTCGAATAAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-1263s21c1
Sequence:CCGGCCTGCATGTTTACCATATCAACTCGAGTTGATATGGTAAACATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015824
VALIDATED
ORC3 MISSION shRNA shRNA Plasmid DNA
origin recognition complex, subunit 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015824.4-3104s21c1
Sequence:CCGGCCTGGCACTTACTAGATATTTCTCGAGAAATATCTAGTAAGTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-1870s21c1
Sequence:CCGGCCATACTATTACCTGAAGAATCTCGAGATTCTTCAGGTAATAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-568s21c1
Sequence:CCGGGCCCTGAAGAAGACAAATTATCTCGAGATAATTTGTCTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015824.2-571s1c1
Sequence:CCGGGCCCTGAAGAAGACAAATTATCTCGAGATAATTTGTCTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-1266s1c1
Sequence:CCGGCCTGCATGTTTACCATATCAACTCGAGTTGATATGGTAAACATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-3107s1c1
Sequence:CCGGCCTGGCACTTACTAGATATTTCTCGAGAAATATCTAGTAAGTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-1873s1c1
Sequence:CCGGCCATACTATTACCTGAAGAATCTCGAGATTCTTCAGGTAATAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015824.2-2080s1c1
Sequence:CCGGGCTCGATTTATTCGAGCTGTTCTCGAGAACAGCTCGAATAAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-1263s21c1
Sequence:CCGGCCTGCATGTTTACCATATCAACTCGAGTTGATATGGTAAACATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015824
VALIDATED
ORC3 MISSION shRNA Lentiviral Transduction Particles
origin recognition complex, subunit 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015824.4-3104s21c1
Sequence:CCGGCCTGGCACTTACTAGATATTTCTCGAGAAATATCTAGTAAGTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-1870s21c1
Sequence:CCGGCCATACTATTACCTGAAGAATCTCGAGATTCTTCAGGTAATAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-568s21c1
Sequence:CCGGGCCCTGAAGAAGACAAATTATCTCGAGATAATTTGTCTTCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015824.2-571s1c1
Sequence:CCGGGCCCTGAAGAAGACAAATTATCTCGAGATAATTTGTCTTCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-1266s1c1
Sequence:CCGGCCTGCATGTTTACCATATCAACTCGAGTTGATATGGTAAACATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-3107s1c1
Sequence:CCGGCCTGGCACTTACTAGATATTTCTCGAGAAATATCTAGTAAGTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015824.2-1873s1c1
Sequence:CCGGCCATACTATTACCTGAAGAATCTCGAGATTCTTCAGGTAATAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015824.2-2080s1c1
Sequence:CCGGGCTCGATTTATTCGAGCTGTTCTCGAGAACAGCTCGAATAAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015824.4-1263s21c1
Sequence:CCGGCCTGCATGTTTACCATATCAACTCGAGTTGATATGGTAAACATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012381
VALIDATED
ORC3 MISSION shRNA Bacterial Glycerol Stock
origin recognition complex, subunit 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012381.2-2294s1c1
Sequence:CCGGCCCATTGATGTTTAACCAGAACTCGAGTTCTGGTTAAACATCAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-924s1c1
Sequence:CCGGCTTACAACTCAGTTTCCCTTTCTCGAGAAAGGGAAACTGAGTTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-354s1c1
Sequence:CCGGGCTCTTGTTCTTGGTGTGAATCTCGAGATTCACACCAAGAACAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012381.2-2192s1c1
Sequence:CCGGGCAAAGCCAGAACTATCACATCTCGAGATGTGATAGTTCTGGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-101s1c1
Sequence:CCGGGAGAAAGATCTCTCTGCCAATCTCGAGATTGGCAGAGAGATCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-112s1c1
Sequence:CCGGCTCTGCCAATAGAGGACTATTCTCGAGAATAGTCCTCTATTGGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-917s1c1
Sequence:CCGGGCTACTTCTTACAACTCAGTTCTCGAGAACTGAGTTGTAAGAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-221s1c1
Sequence:CCGGGCGACTACAAGAGGAATTAAACTCGAGTTTAATTCCTCTTGTAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012381.2-2076s1c1
Sequence:CCGGGCTCGGTTTATTAGAGCTGTTCTCGAGAACAGCTCTAATAAACCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-1202s1c1
Sequence:CCGGGCTCTTGACCAATGAGAGATACTCGAGTATCTCTCATTGGTCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012381
VALIDATED
ORC3 MISSION shRNA shRNA Plasmid DNA
origin recognition complex, subunit 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012381.2-2294s1c1
Sequence:CCGGCCCATTGATGTTTAACCAGAACTCGAGTTCTGGTTAAACATCAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-924s1c1
Sequence:CCGGCTTACAACTCAGTTTCCCTTTCTCGAGAAAGGGAAACTGAGTTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-354s1c1
Sequence:CCGGGCTCTTGTTCTTGGTGTGAATCTCGAGATTCACACCAAGAACAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012381.2-2192s1c1
Sequence:CCGGGCAAAGCCAGAACTATCACATCTCGAGATGTGATAGTTCTGGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-101s1c1
Sequence:CCGGGAGAAAGATCTCTCTGCCAATCTCGAGATTGGCAGAGAGATCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-112s1c1
Sequence:CCGGCTCTGCCAATAGAGGACTATTCTCGAGAATAGTCCTCTATTGGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-917s1c1
Sequence:CCGGGCTACTTCTTACAACTCAGTTCTCGAGAACTGAGTTGTAAGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-221s1c1
Sequence:CCGGGCGACTACAAGAGGAATTAAACTCGAGTTTAATTCCTCTTGTAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012381.2-2076s1c1
Sequence:CCGGGCTCGGTTTATTAGAGCTGTTCTCGAGAACAGCTCTAATAAACCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-1202s1c1
Sequence:CCGGGCTCTTGACCAATGAGAGATACTCGAGTATCTCTCATTGGTCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012381
VALIDATED
ORC3 MISSION shRNA Lentiviral Transduction Particles
origin recognition complex, subunit 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012381.2-2294s1c1
Sequence:CCGGCCCATTGATGTTTAACCAGAACTCGAGTTCTGGTTAAACATCAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-924s1c1
Sequence:CCGGCTTACAACTCAGTTTCCCTTTCTCGAGAAAGGGAAACTGAGTTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-354s1c1
Sequence:CCGGGCTCTTGTTCTTGGTGTGAATCTCGAGATTCACACCAAGAACAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012381.2-2192s1c1
Sequence:CCGGGCAAAGCCAGAACTATCACATCTCGAGATGTGATAGTTCTGGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-101s1c1
Sequence:CCGGGAGAAAGATCTCTCTGCCAATCTCGAGATTGGCAGAGAGATCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-112s1c1
Sequence:CCGGCTCTGCCAATAGAGGACTATTCTCGAGAATAGTCCTCTATTGGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-917s1c1
Sequence:CCGGGCTACTTCTTACAACTCAGTTCTCGAGAACTGAGTTGTAAGAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-221s1c1
Sequence:CCGGGCGACTACAAGAGGAATTAAACTCGAGTTTAATTCCTCTTGTAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012381.2-2076s1c1
Sequence:CCGGGCTCGGTTTATTAGAGCTGTTCTCGAGAACAGCTCTAATAAACCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012381.2-1202s1c1
Sequence:CCGGGCTCTTGACCAATGAGAGATACTCGAGTATCTCTCATTGGTCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)