EMAIL THIS PAGE TO A FRIEND

ORC5

origin recognition complex, subunit 5

113 Gene Product Result for
Synonyms: ORC5L ORC5P ORC5T
UniProtKB ID: O43913, A4D0P8, O60590, O95268
Gene ID:
Human(5001) Summary: The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Oct 2010]
Mouse(26429) origin recognition complex, subunit 5
Rat(362304) origin recognition complex, subunit 5
domestic guinea pig(100727217) origin recognition complex, subunit 5
naked mole-rat(101718856) origin recognition complex, subunit 5
sheep(101121088) origin recognition complex, subunit 5
fruit fly(34794) Origin recognition complex subunit 5
Zebrafish(406479) origin recognition complex, subunit 5
Thale Cress(829114) origin recognition complex protein 5
chicken(417714) origin recognition complex, subunit 5
dog(609937) origin recognition complex, subunit 5
cow(519409) origin recognition complex, subunit 5
Horse(100058743) origin recognition complex, subunit 5
domestic cat(101085449) origin recognition complex, subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181747 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002553 Rosetta Predictions human pricing
NM_181747 Rosetta Predictions human pricing
NM_001014186 Rosetta Predictions rat pricing
NM_011959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077618 predicted 518
2 SASI_Hs01_00077619 predicted 289
3 SASI_Hs01_00077621 predicted 240
4 SASI_Hs01_00077622 predicted 760
5 SASI_Hs01_00077623 predicted 220
6 SASI_Hs01_00077624 predicted 368
7 SASI_Hs01_00077625 predicted 691
8 SASI_Hs01_00077626 predicted 232
9 SASI_Hs01_00077627 predicted 706
10 SASI_Hs02_00334044 predicted 279
11 SASI_Hs01_00077620 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198736 predicted 524
2 SASI_Hs01_00198737 predicted 292
3 SASI_Hs01_00198739 predicted 240
4 SASI_Hs01_00198740 predicted 753
5 SASI_Hs01_00198741 predicted 217
6 SASI_Hs01_00198742 predicted 370
7 SASI_Hs01_00198743 predicted 693
8 SASI_Hs01_00198744 predicted 237
9 SASI_Hs01_00198745 predicted 703
10 SASI_Hs02_00370357 predicted 280
11 SASI_Hs01_00198738 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116879 predicted 651
2 SASI_Rn02_00201691 predicted 252
3 SASI_Rn01_00116880 predicted 1052
4 SASI_Rn01_00116881 predicted 980
5 SASI_Rn01_00116882 predicted 471
6 SASI_Rn01_00116883 predicted 1241
7 SASI_Rn02_00201692 predicted 1432
8 SASI_Rn01_00116886 predicted 1150
9 SASI_Rn01_00116887 predicted 205
10 SASI_Rn01_00116888 predicted 1470
11 SASI_Rn01_00116884 predicted 346
12 SASI_Rn01_00116885 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173978 predicted 971
2 SASI_Mm01_00173979 predicted 1311
3 SASI_Mm01_00173980 predicted 994
4 SASI_Mm02_00321835 predicted 1194
5 SASI_Mm01_00173981 predicted 490
6 SASI_Mm01_00173982 predicted 588
7 SASI_Mm01_00173983 predicted 1032
8 SASI_Mm01_00173984 predicted 884
9 SASI_Mm01_00173985 predicted 655
10 SASI_Mm01_00173987 predicted 1014
11 SASI_Mm01_00173986 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181747
VALIDATED
ORC5 MISSION shRNA Bacterial Glycerol Stock
origin recognition complex, subunit 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-374s21c1
Sequence:CCGGATGGATGTTCTACTGAAATAACTCGAGTTATTTCAGTAGAACATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-627s21c1
Sequence:CCGGTGAGCCGTTTGTCTTATATTTCTCGAGAAATATAAGACAAACGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-717s21c1
Sequence:CCGGTTTCTATGCTGCCTACATTAACTCGAGTTAATGTAGGCAGCATAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-1020s21c1
Sequence:CCGGAGATACTTCTTCAGCTAATTACTCGAGTAATTAGCTGAAGAAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-787s21c1
Sequence:CCGGAGACATCTGGCAGTACTTAATCTCGAGATTAAGTACTGCCAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-816s21c1
Sequence:CCGGATATTGTGAACCCGTGGTTAACTCGAGTTAACCACGGGTTCACAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-756s21c1
Sequence:CCGGCTACACTGTTTGTCGAGATTTCTCGAGAAATCTCGACAAACAGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-1074s21c1
Sequence:CCGGAGTCAGGAAATAGTGTTATAACTCGAGTTATAACACTATTTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-308s1c1
Sequence:CCGGGCTTTACATTGAGGCTGCTTTCTCGAGAAAGCAGCCTCAATGTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-984s1c1
Sequence:CCGGGAAAGGTATCAGAGGAAGTATCTCGAGATACTTCCTCTGATACCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181747.1-1152s1c1
Sequence:CCGGGAAGCTCTAATTTAATGGGAGCTCGAGCTCCCATTAAATTAGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-276s1c1
Sequence:CCGGGCTCCCACATGTGTTTGTGAACTCGAGTTCACAAACACATGTGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181747
VALIDATED
ORC5 MISSION shRNA shRNA Plasmid DNA
origin recognition complex, subunit 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-374s21c1
Sequence:CCGGATGGATGTTCTACTGAAATAACTCGAGTTATTTCAGTAGAACATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-627s21c1
Sequence:CCGGTGAGCCGTTTGTCTTATATTTCTCGAGAAATATAAGACAAACGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-717s21c1
Sequence:CCGGTTTCTATGCTGCCTACATTAACTCGAGTTAATGTAGGCAGCATAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-1020s21c1
Sequence:CCGGAGATACTTCTTCAGCTAATTACTCGAGTAATTAGCTGAAGAAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-787s21c1
Sequence:CCGGAGACATCTGGCAGTACTTAATCTCGAGATTAAGTACTGCCAGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-816s21c1
Sequence:CCGGATATTGTGAACCCGTGGTTAACTCGAGTTAACCACGGGTTCACAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-756s21c1
Sequence:CCGGCTACACTGTTTGTCGAGATTTCTCGAGAAATCTCGACAAACAGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-1074s21c1
Sequence:CCGGAGTCAGGAAATAGTGTTATAACTCGAGTTATAACACTATTTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-308s1c1
Sequence:CCGGGCTTTACATTGAGGCTGCTTTCTCGAGAAAGCAGCCTCAATGTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-984s1c1
Sequence:CCGGGAAAGGTATCAGAGGAAGTATCTCGAGATACTTCCTCTGATACCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181747.1-1152s1c1
Sequence:CCGGGAAGCTCTAATTTAATGGGAGCTCGAGCTCCCATTAAATTAGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-276s1c1
Sequence:CCGGGCTCCCACATGTGTTTGTGAACTCGAGTTCACAAACACATGTGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181747
VALIDATED
ORC5 MISSION shRNA Lentiviral Transduction Particles
origin recognition complex, subunit 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-374s21c1
Sequence:CCGGATGGATGTTCTACTGAAATAACTCGAGTTATTTCAGTAGAACATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-627s21c1
Sequence:CCGGTGAGCCGTTTGTCTTATATTTCTCGAGAAATATAAGACAAACGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-717s21c1
Sequence:CCGGTTTCTATGCTGCCTACATTAACTCGAGTTAATGTAGGCAGCATAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-1020s21c1
Sequence:CCGGAGATACTTCTTCAGCTAATTACTCGAGTAATTAGCTGAAGAAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181747.1-787s21c1
Sequence:CCGGAGACATCTGGCAGTACTTAATCTCGAGATTAAGTACTGCCAGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-816s21c1
Sequence:CCGGATATTGTGAACCCGTGGTTAACTCGAGTTAACCACGGGTTCACAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-756s21c1
Sequence:CCGGCTACACTGTTTGTCGAGATTTCTCGAGAAATCTCGACAAACAGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181747.1-1074s21c1
Sequence:CCGGAGTCAGGAAATAGTGTTATAACTCGAGTTATAACACTATTTCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-308s1c1
Sequence:CCGGGCTTTACATTGAGGCTGCTTTCTCGAGAAAGCAGCCTCAATGTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-984s1c1
Sequence:CCGGGAAAGGTATCAGAGGAAGTATCTCGAGATACTTCCTCTGATACCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181747.1-1152s1c1
Sequence:CCGGGAAGCTCTAATTTAATGGGAGCTCGAGCTCCCATTAAATTAGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181747.1-276s1c1
Sequence:CCGGGCTCCCACATGTGTTTGTGAACTCGAGTTCACAAACACATGTGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011959
VALIDATED
ORC5 MISSION shRNA Bacterial Glycerol Stock
origin recognition complex, subunit 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.2-1005s1c1
Sequence:CCGGGCATACCTTGCCTCTTATAACCTCGAGGTTATAAGAGGCAAGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-962s21c1
Sequence:CCGGCCACATGGAACTTCCATATTACTCGAGTAATATGGAAGTTCCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-1257s21c1
Sequence:CCGGGGTCATGAAGATCAACTTAATCTCGAGATTAAGTTGATCTTCATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011959.2-1582s21c1
Sequence:CCGGTATTTGGAAGCAACGTGTTAACTCGAGTTAACACGTTGCTTCCAAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-440s21c1
Sequence:CCGGGGATAAAGCTGAGTATCTAAGCTCGAGCTTAGATACTCAGCTTTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011959.2-417s21c1
Sequence:CCGGGACCAGACTGTGTATATTGTTCTCGAGAACAATATACACAGTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-497s1c1
Sequence:CCGGGCAAGAATTGACTGACAGAAACTCGAGTTTCTGTCAGTCAATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-816s1c1
Sequence:CCGGCGCAAACTGTGGAGAAATATTCTCGAGAATATTTCTCCACAGTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-414s1c1
Sequence:CCGGGACCAGACTGTGTATATTGTTCTCGAGAACAATATACACAGTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011959.1-1675s1c1
Sequence:CCGGCCATTTACTTAGGACTGTGTTCTCGAGAACACAGTCCTAAGTAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-1310s1c1
Sequence:CCGGCATCAGAGCTATTGCACGGATCTCGAGATCCGTGCAATAGCTCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-135s1c1
Sequence:CCGGGAGAGACATCATTTCAGCTTTCTCGAGAAAGCTGAAATGATGTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-602s1c1
Sequence:CCGGCCCTGACTATAGCATAGGAAACTCGAGTTTCCTATGCTATAGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011959
VALIDATED
ORC5 MISSION shRNA shRNA Plasmid DNA
origin recognition complex, subunit 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.2-1005s1c1
Sequence:CCGGGCATACCTTGCCTCTTATAACCTCGAGGTTATAAGAGGCAAGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-962s21c1
Sequence:CCGGCCACATGGAACTTCCATATTACTCGAGTAATATGGAAGTTCCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-1257s21c1
Sequence:CCGGGGTCATGAAGATCAACTTAATCTCGAGATTAAGTTGATCTTCATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011959.2-1582s21c1
Sequence:CCGGTATTTGGAAGCAACGTGTTAACTCGAGTTAACACGTTGCTTCCAAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-440s21c1
Sequence:CCGGGGATAAAGCTGAGTATCTAAGCTCGAGCTTAGATACTCAGCTTTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011959.2-417s21c1
Sequence:CCGGGACCAGACTGTGTATATTGTTCTCGAGAACAATATACACAGTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-497s1c1
Sequence:CCGGGCAAGAATTGACTGACAGAAACTCGAGTTTCTGTCAGTCAATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-816s1c1
Sequence:CCGGCGCAAACTGTGGAGAAATATTCTCGAGAATATTTCTCCACAGTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-414s1c1
Sequence:CCGGGACCAGACTGTGTATATTGTTCTCGAGAACAATATACACAGTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011959.1-1675s1c1
Sequence:CCGGCCATTTACTTAGGACTGTGTTCTCGAGAACACAGTCCTAAGTAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-1310s1c1
Sequence:CCGGCATCAGAGCTATTGCACGGATCTCGAGATCCGTGCAATAGCTCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-135s1c1
Sequence:CCGGGAGAGACATCATTTCAGCTTTCTCGAGAAAGCTGAAATGATGTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-602s1c1
Sequence:CCGGCCCTGACTATAGCATAGGAAACTCGAGTTTCCTATGCTATAGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011959
VALIDATED
ORC5 MISSION shRNA Lentiviral Transduction Particles
origin recognition complex, subunit 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.2-1005s1c1
Sequence:CCGGGCATACCTTGCCTCTTATAACCTCGAGGTTATAAGAGGCAAGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-962s21c1
Sequence:CCGGCCACATGGAACTTCCATATTACTCGAGTAATATGGAAGTTCCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-1257s21c1
Sequence:CCGGGGTCATGAAGATCAACTTAATCTCGAGATTAAGTTGATCTTCATGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011959.2-1582s21c1
Sequence:CCGGTATTTGGAAGCAACGTGTTAACTCGAGTTAACACGTTGCTTCCAAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011959.2-440s21c1
Sequence:CCGGGGATAAAGCTGAGTATCTAAGCTCGAGCTTAGATACTCAGCTTTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011959.2-417s21c1
Sequence:CCGGGACCAGACTGTGTATATTGTTCTCGAGAACAATATACACAGTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-497s1c1
Sequence:CCGGGCAAGAATTGACTGACAGAAACTCGAGTTTCTGTCAGTCAATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-816s1c1
Sequence:CCGGCGCAAACTGTGGAGAAATATTCTCGAGAATATTTCTCCACAGTTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011959.1-414s1c1
Sequence:CCGGGACCAGACTGTGTATATTGTTCTCGAGAACAATATACACAGTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011959.1-1675s1c1
Sequence:CCGGCCATTTACTTAGGACTGTGTTCTCGAGAACACAGTCCTAAGTAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-1310s1c1
Sequence:CCGGCATCAGAGCTATTGCACGGATCTCGAGATCCGTGCAATAGCTCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-135s1c1
Sequence:CCGGGAGAGACATCATTTCAGCTTTCTCGAGAAAGCTGAAATGATGTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011959.1-602s1c1
Sequence:CCGGCCCTGACTATAGCATAGGAAACTCGAGTTTCCTATGCTATAGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)