EMAIL THIS PAGE TO A FRIEND

ORM1

orosomucoid 1

55 Gene Product Result for
Synonyms: AGP-A AGP1 ORM
UniProtKB ID: P02763, B7ZKQ5, Q5T539, Q5U067, Q8TC16
Gene ID:
Human(5004) Summary: This gene encodes a key acute phase plasma protein. Because of its increase due to acute inflammation, this protein is classified as an acute-phase reactant. The specific function of this protein has not yet been determined; however, it may be involved in aspects of immunosuppression. [provided by RefSeq, Jul 2008]
Mouse(18405) orosomucoid 1
Rat(24614) orosomucoid 1
chicken(395220) orosomucoid 1 (ovoglycoprotein)
cow(497200) orosomucoid 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22927F Anti-α-1-Acid Glycoprotein 1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
A3418 Anti-α1-Acid Glycoprotein antibody produced in goat whole antiserum human
quantitative precipitin assay pricing
SAB1406203 Anti-ORM1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA046438 Anti-ORM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410864 Anti-ORM1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA057726 Anti-ORM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA047725 Anti-ORM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
A5566 Monoclonal Anti-α1-Acid Glycoprotein antibody produced in mouse clone AGP-47, ascites fluid human, baboon (weakly)
dot blot, ELISA, western blot pricing
WH0005004M1 Monoclonal Anti-ORM1 antibody produced in mouse clone 2F9-1F10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116821 MISSION® esiRNA esiRNA human ORM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000607 Rosetta Predictions human pricing
NM_053288 Rosetta Predictions rat pricing
NM_008768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183905 predicted 364
2 SASI_Hs02_00302901 predicted 215
3 SASI_Hs02_00302902 predicted 528
4 SASI_Hs02_00302903 predicted 215
5 SASI_Hs02_00302904 predicted 248
6 SASI_Hs01_00183906 predicted 385
7 SASI_Hs02_00302905 predicted 254
8 SASI_Hs02_00302906 predicted 555
9 SASI_Hs02_00302907 predicted 285
10 SASI_Hs02_00302908 predicted 332
11 SASI_Hs01_00183907 predicted 411
12 SASI_Hs01_00183908 predicted 440
13 SASI_Hs01_00183909 predicted 345
14 SASI_Hs01_00183910 predicted 341
15 SASI_Hs01_00183911 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043187 predicted 408
2 SASI_Rn01_00043188 predicted 295
3 SASI_Rn01_00043189 predicted 329
4 SASI_Rn02_00265651 predicted 409
5 SASI_Rn01_00043191 predicted 210
6 SASI_Rn01_00043192 predicted 316
7 SASI_Rn01_00043193 predicted 424
8 SASI_Rn01_00043194 predicted 262
9 SASI_Rn01_00043195 predicted 215
10 SASI_Rn01_00043196 predicted 342
11 SASI_Rn01_00043190 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066674 predicted 199
2 SASI_Mm01_00066675 predicted 240
3 SASI_Mm01_00066676 predicted 379
4 SASI_Mm01_00066677 predicted 383
5 SASI_Mm01_00066678 predicted 318
6 SASI_Mm01_00066679 predicted 424
7 SASI_Mm01_00066680 predicted 380
8 SASI_Mm01_00066681 predicted 276
9 SASI_Mm01_00066682 predicted 370
10 SASI_Mm01_00066683 predicted 54
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008768
ORM1 MISSION shRNA Bacterial Glycerol Stock
orosomucoid 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-420s21c1
Sequence:CCGAATGCTTGCCTTTGACCTCAAGCTCGAGCTTGAGGTCAAAGGCAAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-318s21c1
Sequence:CCGGACCCATCTAGGATTCCAGAGACTCGAGTCTCTGGAATCCTAGATGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-59s21c1
Sequence:CCGGATTGAGCCTTCTGCCGATGTTCTCGAGAACATCGGCAGAAGGCTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-119s21c1
Sequence:CCGGCGAACCTATCACCAATGAGACCTCGAGGTCTCATTGGTGATAGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-386s1c1
Sequence:CCGGCCACCTTATAGTGCTGAGGAACTCGAGTTCCTCAGCACTATAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-200s1c1
Sequence:CCGGCAGGCAGGCAATTCAAACAATCTCGAGATTGTTTGAATTGCCTGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-169s1c1
Sequence:CCGGTCATGGGTGCAGCTTTCAGAACTCGAGTTCTGAAAGCTGCACCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-375s1c1
Sequence:CCGGGAAACCTTTGCCCACCTTATACTCGAGTATAAGGTGGGCAAAGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-272s1c1
Sequence:CCGGGCTTCGGGAGTCTCAAACAATCTCGAGATTGTTTGAGACTCCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008768
ORM1 MISSION shRNA shRNA Plasmid DNA
orosomucoid 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-420s21c1
Sequence:CCGAATGCTTGCCTTTGACCTCAAGCTCGAGCTTGAGGTCAAAGGCAAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-318s21c1
Sequence:CCGGACCCATCTAGGATTCCAGAGACTCGAGTCTCTGGAATCCTAGATGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-59s21c1
Sequence:CCGGATTGAGCCTTCTGCCGATGTTCTCGAGAACATCGGCAGAAGGCTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-119s21c1
Sequence:CCGGCGAACCTATCACCAATGAGACCTCGAGGTCTCATTGGTGATAGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-386s1c1
Sequence:CCGGCCACCTTATAGTGCTGAGGAACTCGAGTTCCTCAGCACTATAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-200s1c1
Sequence:CCGGCAGGCAGGCAATTCAAACAATCTCGAGATTGTTTGAATTGCCTGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-169s1c1
Sequence:CCGGTCATGGGTGCAGCTTTCAGAACTCGAGTTCTGAAAGCTGCACCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-375s1c1
Sequence:CCGGGAAACCTTTGCCCACCTTATACTCGAGTATAAGGTGGGCAAAGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-272s1c1
Sequence:CCGGGCTTCGGGAGTCTCAAACAATCTCGAGATTGTTTGAGACTCCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008768
ORM1 MISSION shRNA Lentiviral Transduction Particles
orosomucoid 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-420s21c1
Sequence:CCGAATGCTTGCCTTTGACCTCAAGCTCGAGCTTGAGGTCAAAGGCAAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-318s21c1
Sequence:CCGGACCCATCTAGGATTCCAGAGACTCGAGTCTCTGGAATCCTAGATGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-59s21c1
Sequence:CCGGATTGAGCCTTCTGCCGATGTTCTCGAGAACATCGGCAGAAGGCTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008768.1-119s21c1
Sequence:CCGGCGAACCTATCACCAATGAGACCTCGAGGTCTCATTGGTGATAGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-386s1c1
Sequence:CCGGCCACCTTATAGTGCTGAGGAACTCGAGTTCCTCAGCACTATAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-200s1c1
Sequence:CCGGCAGGCAGGCAATTCAAACAATCTCGAGATTGTTTGAATTGCCTGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-169s1c1
Sequence:CCGGTCATGGGTGCAGCTTTCAGAACTCGAGTTCTGAAAGCTGCACCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-375s1c1
Sequence:CCGGGAAACCTTTGCCCACCTTATACTCGAGTATAAGGTGGGCAAAGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008768.1-272s1c1
Sequence:CCGGGCTTCGGGAGTCTCAAACAATCTCGAGATTGTTTGAGACTCCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000607
ORM1 MISSION shRNA Bacterial Glycerol Stock
orosomucoid 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000607.2-368s21c1
Sequence:CCGGGACAGGACCAGTGCATCTATACTCGAGTATAGATGCACTGGTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000607.2-623s21c1
Sequence:CCGGCAGATGTCGTGTACACCGATTCTCGAGAATCGGTGTACACGACATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-351s1c1
Sequence:CCGGCTATAACACCACCTACCTGAACTCGAGTTCAGGTAGGTGGTGTTATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-501s1c1
Sequence:CCGGGCTGTCTGTCTATGCTGACAACTCGAGTTGTCAGCATAGACAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-474s1c1
Sequence:CCGGTGACGTGAACGATGAGAAGAACTCGAGTTCTTCTCATCGTTCACGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-414s1c1
Sequence:CCGGCCAAGAGCATTTCGCTCACTTCTCGAGAAGTGAGCGAAATGCTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-452s1c1
Sequence:CCGGCCAAGACCTACATGCTTGCTTCTCGAGAAGCAAGCATGTAGGTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000607
ORM1 MISSION shRNA shRNA Plasmid DNA
orosomucoid 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000607.2-368s21c1
Sequence:CCGGGACAGGACCAGTGCATCTATACTCGAGTATAGATGCACTGGTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000607.2-623s21c1
Sequence:CCGGCAGATGTCGTGTACACCGATTCTCGAGAATCGGTGTACACGACATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-351s1c1
Sequence:CCGGCTATAACACCACCTACCTGAACTCGAGTTCAGGTAGGTGGTGTTATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-501s1c1
Sequence:CCGGGCTGTCTGTCTATGCTGACAACTCGAGTTGTCAGCATAGACAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-474s1c1
Sequence:CCGGTGACGTGAACGATGAGAAGAACTCGAGTTCTTCTCATCGTTCACGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-414s1c1
Sequence:CCGGCCAAGAGCATTTCGCTCACTTCTCGAGAAGTGAGCGAAATGCTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-452s1c1
Sequence:CCGGCCAAGACCTACATGCTTGCTTCTCGAGAAGCAAGCATGTAGGTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000607
ORM1 MISSION shRNA Lentiviral Transduction Particles
orosomucoid 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000607.2-368s21c1
Sequence:CCGGGACAGGACCAGTGCATCTATACTCGAGTATAGATGCACTGGTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000607.2-623s21c1
Sequence:CCGGCAGATGTCGTGTACACCGATTCTCGAGAATCGGTGTACACGACATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-351s1c1
Sequence:CCGGCTATAACACCACCTACCTGAACTCGAGTTCAGGTAGGTGGTGTTATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-501s1c1
Sequence:CCGGGCTGTCTGTCTATGCTGACAACTCGAGTTGTCAGCATAGACAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-474s1c1
Sequence:CCGGTGACGTGAACGATGAGAAGAACTCGAGTTCTTCTCATCGTTCACGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-414s1c1
Sequence:CCGGCCAAGAGCATTTCGCTCACTTCTCGAGAAGTGAGCGAAATGCTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000607.1-452s1c1
Sequence:CCGGCCAAGACCTACATGCTTGCTTCTCGAGAAGCAAGCATGTAGGTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)