EMAIL THIS PAGE TO A FRIEND

ORMDL1

ORM1-like 1 (S. cerevisiae)

99 Gene Product Result for
UniProtKB ID: Q9P0S3, B2R8W3, D3DPH9
Gene ID:
Mouse(227102) ORM1-like 1 (S. cerevisiae)
Rat(100188936) ORM1-like 1 (S. cerevisiae)
Zebrafish(368632) ORM1-like 1 (S. cerevisiae)
chicken(423981) ORM1-like 1 (S. cerevisiae)
domestic cat(101080649) ORM1-like 1 (S. cerevisiae)
cow(768077) ORM1-like 1 (S. cerevisiae)
dog(606834) ORM1-like 1 (S. cerevisiae)
Goat(100861146) ORM1-like 1 (S. cerevisiae)
sheep(101112289) ORM1-like 1 (S. cerevisiae)
domestic guinea pig(100716505) ORM1-like 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500626 Anti-ORMDL1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
HPA065643 Anti-ORMDL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016467 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005371 MISSION® esiRNA esiRNA targeting human ORMDL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128150 Rosetta Predictions human pricing
NM_016467 Rosetta Predictions human pricing
NM_001134704 Rosetta Predictions rat pricing
NM_145517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330606 predicted 239
2 SASI_Hs02_00330607 predicted 805
3 SASI_Hs02_00330608 predicted 933
4 SASI_Hs02_00330609 predicted 988
5 SASI_Hs02_00330610 predicted 875
6 SASI_Hs02_00330611 predicted 1048
7 SASI_Hs02_00330612 predicted 980
8 SASI_Hs02_00330613 predicted 302
9 SASI_Hs02_00330614 predicted 806
10 SASI_Hs02_00330615 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067445 predicted 240
2 SASI_Hs01_00067446 predicted 809
3 SASI_Hs01_00067447 predicted 930
4 SASI_Hs02_00349513 predicted 986
5 SASI_Hs01_00067449 predicted 874
6 SASI_Hs01_00067450 predicted 1048
7 SASI_Hs01_00067451 predicted 1023
8 SASI_Hs01_00067452 predicted 975
9 SASI_Hs01_00067453 predicted 310
10 SASI_Hs02_00349514 predicted 808
11 SASI_Hs01_00067448 predicted 992
12 SASI_Hs01_00067454 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258054 predicted 610
2 SASI_Rn02_00258055 predicted 858
3 SASI_Rn02_00258056 predicted 582
4 SASI_Rn02_00258057 predicted 666
5 SASI_Rn02_00258058 predicted 598
6 SASI_Rn02_00258059 predicted 451
7 SASI_Rn02_00258060 predicted 265
8 SASI_Rn02_00258061 predicted 374
9 SASI_Rn02_00258062 predicted 389
10 SASI_Rn02_00258063 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340986 predicted 800
2 SASI_Mm02_00340987 predicted 627
3 SASI_Mm01_00092680 predicted 433
4 SASI_Mm02_00340988 predicted 238
5 SASI_Mm02_00340989 predicted 645
6 SASI_Mm01_00092682 predicted 591
7 SASI_Mm01_00092684 predicted 602
8 SASI_Mm02_00340990 predicted 807
9 SASI_Mm01_00092685 predicted 543
10 SASI_Mm01_00092686 predicted 540
11 SASI_Mm01_00092677 predicted 234
12 SASI_Mm01_00092678 predicted 360
13 SASI_Mm01_00092679 predicted 393
14 SASI_Mm01_00092681 predicted 146
15 SASI_Mm01_00092683 predicted 995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145517
VALIDATED
ORMDL1 MISSION shRNA Bacterial Glycerol Stock
ORM1-like 1 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-226s1c1
Sequence:CCGGGCCTGGACCTTAACCAACATACTCGAGTATGTTGGTTAAGGTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145517.4-601s21c1
Sequence:CCGGCTGTAATGAAAGAGTAGTTAACTCGAGTTAACTACTCTTTCATTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-437s21c1
Sequence:CCGGGGCAAGTTTCTATACAAAGTACTCGAGTACTTTGTATAGAAACTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-515s1c1
Sequence:CCGGGTGTTCGCATCTTTGGAATTACTCGAGTAATTCCAAAGATGCGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-490s21c1
Sequence:CCGGCTCTGCTGAGTGTACTTATTCCTCGAGGAATAAGTACACTCAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-197s21c1
Sequence:CCGGGCTTCATATTGTATTACTCAGCTCGAGCTGAGTAATACAATATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-366s1c1
Sequence:CCGGGTTTACATCTTCTCGGAAGTTCTCGAGAACTTCCGAGAAGATGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145517.2-1511s1c1
Sequence:CCGGGCCCATTAATATTTCCTGTAACTCGAGTTACAGGAAATATTAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-146s21c1
Sequence:CCGGTGTAATGAACAGCCGTGGTATCTCGAGATACCACGGCTGTTCATTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145517.4-811s21c1
Sequence:CCGGGATAAGAGTACAGTAACTAAACTCGAGTTTAGTTACTGTACTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145517
VALIDATED
ORMDL1 MISSION shRNA shRNA Plasmid DNA
ORM1-like 1 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-226s1c1
Sequence:CCGGGCCTGGACCTTAACCAACATACTCGAGTATGTTGGTTAAGGTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145517.4-601s21c1
Sequence:CCGGCTGTAATGAAAGAGTAGTTAACTCGAGTTAACTACTCTTTCATTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-437s21c1
Sequence:CCGGGGCAAGTTTCTATACAAAGTACTCGAGTACTTTGTATAGAAACTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-515s1c1
Sequence:CCGGGTGTTCGCATCTTTGGAATTACTCGAGTAATTCCAAAGATGCGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-490s21c1
Sequence:CCGGCTCTGCTGAGTGTACTTATTCCTCGAGGAATAAGTACACTCAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-197s21c1
Sequence:CCGGGCTTCATATTGTATTACTCAGCTCGAGCTGAGTAATACAATATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-366s1c1
Sequence:CCGGGTTTACATCTTCTCGGAAGTTCTCGAGAACTTCCGAGAAGATGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145517.2-1511s1c1
Sequence:CCGGGCCCATTAATATTTCCTGTAACTCGAGTTACAGGAAATATTAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-146s21c1
Sequence:CCGGTGTAATGAACAGCCGTGGTATCTCGAGATACCACGGCTGTTCATTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145517.4-811s21c1
Sequence:CCGGGATAAGAGTACAGTAACTAAACTCGAGTTTAGTTACTGTACTCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145517
VALIDATED
ORMDL1 MISSION shRNA Lentiviral Transduction Particles
ORM1-like 1 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-226s1c1
Sequence:CCGGGCCTGGACCTTAACCAACATACTCGAGTATGTTGGTTAAGGTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145517.4-601s21c1
Sequence:CCGGCTGTAATGAAAGAGTAGTTAACTCGAGTTAACTACTCTTTCATTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-437s21c1
Sequence:CCGGGGCAAGTTTCTATACAAAGTACTCGAGTACTTTGTATAGAAACTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-515s1c1
Sequence:CCGGGTGTTCGCATCTTTGGAATTACTCGAGTAATTCCAAAGATGCGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-490s21c1
Sequence:CCGGCTCTGCTGAGTGTACTTATTCCTCGAGGAATAAGTACACTCAGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-197s21c1
Sequence:CCGGGCTTCATATTGTATTACTCAGCTCGAGCTGAGTAATACAATATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145517.2-366s1c1
Sequence:CCGGGTTTACATCTTCTCGGAAGTTCTCGAGAACTTCCGAGAAGATGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145517.2-1511s1c1
Sequence:CCGGGCCCATTAATATTTCCTGTAACTCGAGTTACAGGAAATATTAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145517.4-146s21c1
Sequence:CCGGTGTAATGAACAGCCGTGGTATCTCGAGATACCACGGCTGTTCATTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145517.4-811s21c1
Sequence:CCGGGATAAGAGTACAGTAACTAAACTCGAGTTTAGTTACTGTACTCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016467
VALIDATED
ORMDL1 MISSION shRNA Bacterial Glycerol Stock
ORM1-like 1 (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-504s1c1
Sequence:CCGGCCTGAGTGTACTAATTCCCAACTCGAGTTGGGAATTAGTACACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016467.3-328s1c1
Sequence:CCGGGAAACTCCTGACCAGGGTAAACTCGAGTTTACCCTGGTCAGGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016467.3-1054s1c1
Sequence:CCGGCGGATGTATATCCTCTTGTTTCTCGAGAAACAAGAGGATATACATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016467.4-457s21c1
Sequence:CCGGAGCAAGGCTCCTAACTCATTGCTCGAGCAATGAGTTAGGAGCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-993s21c1
Sequence:CCGGTAGGACCAGCTTAACTTATAACTCGAGTTATAAGTTAAGCTGGTCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-448s1c1
Sequence:CCGGGCAAGTTTCTATACGAAGTATCTCGAGATACTTCGTATAGAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-544s1c1
Sequence:CCGGGTTCGGATCTTTGGAATTAATCTCGAGATTAATTCCAAAGATCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-645s21c1
Sequence:CCGGTACATGGTGTTCGGATCTTTGCTCGAGCAAAGATCCGAACACCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016467.3-535s1c1
Sequence:CCGGCTACATGGTGTTCGGATCTTTCTCGAGAAAGATCCGAACACCATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-393s1c1
Sequence:CCGGGTTTACATCTTCACGGAAGTTCTCGAGAACTTCCGTGAAGATGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-943s21c1
Sequence:CCGGAGTGAGGGTGTAGTAGATAAACTCGAGTTTATCTACTACACCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-361s21c1
Sequence:CCGGTGCTTGGACTTTAACAAATATCTCGAGATATTTGTTAAAGTCCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-305s21c1
Sequence:CCGGGGAGTTGGCTTGCTTCATATTCTCGAGAATATGAAGCAAGCCAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016467
VALIDATED
ORMDL1 MISSION shRNA shRNA Plasmid DNA
ORM1-like 1 (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-504s1c1
Sequence:CCGGCCTGAGTGTACTAATTCCCAACTCGAGTTGGGAATTAGTACACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016467.3-328s1c1
Sequence:CCGGGAAACTCCTGACCAGGGTAAACTCGAGTTTACCCTGGTCAGGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016467.3-1054s1c1
Sequence:CCGGCGGATGTATATCCTCTTGTTTCTCGAGAAACAAGAGGATATACATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016467.4-457s21c1
Sequence:CCGGAGCAAGGCTCCTAACTCATTGCTCGAGCAATGAGTTAGGAGCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-993s21c1
Sequence:CCGGTAGGACCAGCTTAACTTATAACTCGAGTTATAAGTTAAGCTGGTCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-448s1c1
Sequence:CCGGGCAAGTTTCTATACGAAGTATCTCGAGATACTTCGTATAGAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-544s1c1
Sequence:CCGGGTTCGGATCTTTGGAATTAATCTCGAGATTAATTCCAAAGATCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-645s21c1
Sequence:CCGGTACATGGTGTTCGGATCTTTGCTCGAGCAAAGATCCGAACACCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016467.3-535s1c1
Sequence:CCGGCTACATGGTGTTCGGATCTTTCTCGAGAAAGATCCGAACACCATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-393s1c1
Sequence:CCGGGTTTACATCTTCACGGAAGTTCTCGAGAACTTCCGTGAAGATGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-943s21c1
Sequence:CCGGAGTGAGGGTGTAGTAGATAAACTCGAGTTTATCTACTACACCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-361s21c1
Sequence:CCGGTGCTTGGACTTTAACAAATATCTCGAGATATTTGTTAAAGTCCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-305s21c1
Sequence:CCGGGGAGTTGGCTTGCTTCATATTCTCGAGAATATGAAGCAAGCCAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016467
VALIDATED
ORMDL1 MISSION shRNA Lentiviral Transduction Particles
ORM1-like 1 (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-504s1c1
Sequence:CCGGCCTGAGTGTACTAATTCCCAACTCGAGTTGGGAATTAGTACACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016467.3-328s1c1
Sequence:CCGGGAAACTCCTGACCAGGGTAAACTCGAGTTTACCCTGGTCAGGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016467.3-1054s1c1
Sequence:CCGGCGGATGTATATCCTCTTGTTTCTCGAGAAACAAGAGGATATACATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016467.4-457s21c1
Sequence:CCGGAGCAAGGCTCCTAACTCATTGCTCGAGCAATGAGTTAGGAGCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-993s21c1
Sequence:CCGGTAGGACCAGCTTAACTTATAACTCGAGTTATAAGTTAAGCTGGTCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-448s1c1
Sequence:CCGGGCAAGTTTCTATACGAAGTATCTCGAGATACTTCGTATAGAAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-544s1c1
Sequence:CCGGGTTCGGATCTTTGGAATTAATCTCGAGATTAATTCCAAAGATCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-645s21c1
Sequence:CCGGTACATGGTGTTCGGATCTTTGCTCGAGCAAAGATCCGAACACCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016467.3-535s1c1
Sequence:CCGGCTACATGGTGTTCGGATCTTTCTCGAGAAAGATCCGAACACCATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016467.3-393s1c1
Sequence:CCGGGTTTACATCTTCACGGAAGTTCTCGAGAACTTCCGTGAAGATGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-943s21c1
Sequence:CCGGAGTGAGGGTGTAGTAGATAAACTCGAGTTTATCTACTACACCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-361s21c1
Sequence:CCGGTGCTTGGACTTTAACAAATATCTCGAGATATTTGTTAAAGTCCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016467.4-305s21c1
Sequence:CCGGGGAGTTGGCTTGCTTCATATTCTCGAGAATATGAAGCAAGCCAACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)