EMAIL THIS PAGE TO A FRIEND

ORMDL3

ORM1-like 3 (S. cerevisiae)

70 Gene Product Result for
UniProtKB ID: Q8N138, B3KS83, Q6UY83
Gene ID:
Mouse(66612) ORM1-like 3 (S. cerevisiae)
Rat(360618) ORM1-like 3 (S. cerevisiae)
Zebrafish(450067) ORM1-like 3 (S. cerevisiae)
chicken(426131) ORM1-like 3 (S. cerevisiae)
cow(615368) ORM1-like 3 (S. cerevisiae)
domestic cat(101093408) ORM1-like 3 (S. cerevisiae)
dog(480530) ORM1-like 3 (S. cerevisiae)
sheep(101105342) ORM1-like 3 (S. cerevisiae)
naked mole-rat(101701907) ORM1-like 3 (S. cerevisiae)
domestic guinea pig(100728221) ORM1-like 3 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139280 Rosetta Predictions human pricing
NM_001047897 Rosetta Predictions rat pricing
NM_025661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044240 predicted 466
2 SASI_Hs01_00044242 predicted 941
3 SASI_Hs01_00044243 predicted 431
4 SASI_Hs01_00044245 predicted 653
5 SASI_Hs01_00044246 predicted 444
6 SASI_Hs01_00044247 predicted 1016
7 SASI_Hs02_00364266 predicted 428
8 SASI_Hs01_00044248 predicted 750
9 SASI_Hs01_00044249 predicted 443
10 SASI_Hs02_00364267 predicted 488
11 SASI_Hs01_00044241 predicted 1084
12 SASI_Hs01_00044244 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206587 predicted 227
2 SASI_Rn02_00206588 predicted 269
3 SASI_Rn02_00206589 predicted 225
4 SASI_Rn02_00206590 predicted 254
5 SASI_Rn02_00206591 predicted 236
6 SASI_Rn02_00206592 predicted 258
7 SASI_Rn02_00206593 predicted 261
8 SASI_Rn02_00206594 predicted 240
9 SASI_Rn02_00206595 predicted 238
10 SASI_Rn02_00206596 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081510 predicted 993
2 SASI_Mm01_00081511 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139280
VALIDATED
ORMDL3 MISSION shRNA Bacterial Glycerol Stock
ORM1-like 3 (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-1445s1c1
Sequence:CCGGCCCACAGAATGTGATAGTAATCTCGAGATTACTATCACATTCTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139280.1-435s1c1
Sequence:CCGGCGGAAGTTCTTGACCATCACACTCGAGTGTGATGGTCAAGAACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139280.1-293s1c1
Sequence:CCGGCACCAACCTCATTCACAACATCTCGAGATGTTGTGAATGAGGTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-320s1c1
Sequence:CCGGGTATATCTTCCTGCACACGGTCTCGAGACCGTGTGCAGGAAGATATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-1423s1c1
Sequence:CCGGGCAGGCTTGGAGGGTTAATTTCTCGAGAAATTAACCCTCCAAGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-311s1c1
Sequence:CCGGCATGGGCATGTATATCTTCCTCTCGAGAGGAAGATATACATGCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139280.1-1446s1c1
Sequence:CCGGCCACAGAATGTGATAGTAATACTCGAGTATTACTATCACATTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139280.1-527s21c1
Sequence:CCGGGTCCCTGATGAGCGTGCTTATCTCGAGATAAGCACGCTCATCAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139280
VALIDATED
ORMDL3 MISSION shRNA shRNA Plasmid DNA
ORM1-like 3 (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-1445s1c1
Sequence:CCGGCCCACAGAATGTGATAGTAATCTCGAGATTACTATCACATTCTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139280.1-435s1c1
Sequence:CCGGCGGAAGTTCTTGACCATCACACTCGAGTGTGATGGTCAAGAACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139280.1-293s1c1
Sequence:CCGGCACCAACCTCATTCACAACATCTCGAGATGTTGTGAATGAGGTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-320s1c1
Sequence:CCGGGTATATCTTCCTGCACACGGTCTCGAGACCGTGTGCAGGAAGATATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-1423s1c1
Sequence:CCGGGCAGGCTTGGAGGGTTAATTTCTCGAGAAATTAACCCTCCAAGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-311s1c1
Sequence:CCGGCATGGGCATGTATATCTTCCTCTCGAGAGGAAGATATACATGCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139280.1-1446s1c1
Sequence:CCGGCCACAGAATGTGATAGTAATACTCGAGTATTACTATCACATTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139280.1-527s21c1
Sequence:CCGGGTCCCTGATGAGCGTGCTTATCTCGAGATAAGCACGCTCATCAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139280
VALIDATED
ORMDL3 MISSION shRNA Lentiviral Transduction Particles
ORM1-like 3 (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-1445s1c1
Sequence:CCGGCCCACAGAATGTGATAGTAATCTCGAGATTACTATCACATTCTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139280.1-435s1c1
Sequence:CCGGCGGAAGTTCTTGACCATCACACTCGAGTGTGATGGTCAAGAACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139280.1-293s1c1
Sequence:CCGGCACCAACCTCATTCACAACATCTCGAGATGTTGTGAATGAGGTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-320s1c1
Sequence:CCGGGTATATCTTCCTGCACACGGTCTCGAGACCGTGTGCAGGAAGATATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-1423s1c1
Sequence:CCGGGCAGGCTTGGAGGGTTAATTTCTCGAGAAATTAACCCTCCAAGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139280.1-311s1c1
Sequence:CCGGCATGGGCATGTATATCTTCCTCTCGAGAGGAAGATATACATGCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139280.1-1446s1c1
Sequence:CCGGCCACAGAATGTGATAGTAATACTCGAGTATTACTATCACATTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139280.1-527s21c1
Sequence:CCGGGTCCCTGATGAGCGTGCTTATCTCGAGATAAGCACGCTCATCAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025661
VALIDATED
ORMDL3 MISSION shRNA Bacterial Glycerol Stock
ORM1-like 3 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-294s1c1
Sequence:CCGGCCTCACCAACCTTATCCACAACTCGAGTTGTGGATAAGGTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025661.1-494s1c1
Sequence:CCGGCCAAGTATGACCAAGTCCATTCTCGAGAATGGACTTGGTCATACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-504s1c1
Sequence:CCGGCCAAGTCCATTTCATACTCAACTCGAGTTGAGTATGAAATGGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025661.1-895s1c1
Sequence:CCGGCCTGAGAAATTGGGACAGGAACTCGAGTTCCTGTCCCAATTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-579s1c1
Sequence:CCGGCCGGATCTTTGGAATCAATAACTCGAGTTATTGATTCCAAAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-578s21c1
Sequence:CCGGCCGGATCTTTGGAATCAATAACTCGAGTTATTGATTCCAAAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-445s21c1
Sequence:CCGGTCTTAACCATCACGCCTATAGCTCGAGCTATAGGCGTGATGGTTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-493s21c1
Sequence:CCGGCCAAGTATGACCAAGTCCATTCTCGAGAATGGACTTGGTCATACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025661.4-744s21c1
Sequence:CCGGGCCGACTTGGAGTAGCTTGTACTCGAGTACAAGCTACTCCAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-293s21c1
Sequence:CCGGCCTCACCAACCTTATCCACAACTCGAGTTGTGGATAAGGTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025661
VALIDATED
ORMDL3 MISSION shRNA shRNA Plasmid DNA
ORM1-like 3 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-294s1c1
Sequence:CCGGCCTCACCAACCTTATCCACAACTCGAGTTGTGGATAAGGTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025661.1-494s1c1
Sequence:CCGGCCAAGTATGACCAAGTCCATTCTCGAGAATGGACTTGGTCATACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-504s1c1
Sequence:CCGGCCAAGTCCATTTCATACTCAACTCGAGTTGAGTATGAAATGGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025661.1-895s1c1
Sequence:CCGGCCTGAGAAATTGGGACAGGAACTCGAGTTCCTGTCCCAATTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-579s1c1
Sequence:CCGGCCGGATCTTTGGAATCAATAACTCGAGTTATTGATTCCAAAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-578s21c1
Sequence:CCGGCCGGATCTTTGGAATCAATAACTCGAGTTATTGATTCCAAAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-445s21c1
Sequence:CCGGTCTTAACCATCACGCCTATAGCTCGAGCTATAGGCGTGATGGTTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-493s21c1
Sequence:CCGGCCAAGTATGACCAAGTCCATTCTCGAGAATGGACTTGGTCATACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025661.4-744s21c1
Sequence:CCGGGCCGACTTGGAGTAGCTTGTACTCGAGTACAAGCTACTCCAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-293s21c1
Sequence:CCGGCCTCACCAACCTTATCCACAACTCGAGTTGTGGATAAGGTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025661
VALIDATED
ORMDL3 MISSION shRNA Lentiviral Transduction Particles
ORM1-like 3 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-294s1c1
Sequence:CCGGCCTCACCAACCTTATCCACAACTCGAGTTGTGGATAAGGTTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025661.1-494s1c1
Sequence:CCGGCCAAGTATGACCAAGTCCATTCTCGAGAATGGACTTGGTCATACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-504s1c1
Sequence:CCGGCCAAGTCCATTTCATACTCAACTCGAGTTGAGTATGAAATGGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025661.1-895s1c1
Sequence:CCGGCCTGAGAAATTGGGACAGGAACTCGAGTTCCTGTCCCAATTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025661.1-579s1c1
Sequence:CCGGCCGGATCTTTGGAATCAATAACTCGAGTTATTGATTCCAAAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-578s21c1
Sequence:CCGGCCGGATCTTTGGAATCAATAACTCGAGTTATTGATTCCAAAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-445s21c1
Sequence:CCGGTCTTAACCATCACGCCTATAGCTCGAGCTATAGGCGTGATGGTTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-493s21c1
Sequence:CCGGCCAAGTATGACCAAGTCCATTCTCGAGAATGGACTTGGTCATACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025661.4-744s21c1
Sequence:CCGGGCCGACTTGGAGTAGCTTGTACTCGAGTACAAGCTACTCCAAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025661.4-293s21c1
Sequence:CCGGCCTCACCAACCTTATCCACAACTCGAGTTGTGGATAAGGTTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)