EMAIL THIS PAGE TO A FRIEND

OS9

osteosarcoma amplified 9, endoplasmic reticulum lectin

77 Gene Product Result for
Synonyms: ERLEC2 OS-9
Gene ID:
Human(10956) Summary: This gene encodes a protein that is highly expressed in osteosarcomas. This protein binds to the hypoxia-inducible factor 1 (HIF-1), a key regulator of the hypoxic response and angiogenesis, and promotes the degradation of one of its subunits. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(216440) amplified in osteosarcoma
Rat(362891) osteosarcoma amplified 9
fruit fly(59167) Olfactory-specific 9
cow(504832) osteosarcoma amplified 9, endoplasmic reticulum lectin
Zebrafish(553455) amplified in osteosarcoma
dog(474419) osteosarcoma amplified 9, endoplasmic reticulum lectin
domestic cat(101095992) osteosarcoma amplified 9, endoplasmic reticulum lectin
Horse(100050776) osteosarcoma amplified 9, endoplasmic reticulum lectin
sheep(101117150) osteosarcoma amplified 9, endoplasmic reticulum lectin
Domestic Rabbit(100345796) osteosarcoma amplified 9, endoplasmic reticulum lectin
naked mole-rat(101706809) osteosarcoma amplified 9, endoplasmic reticulum lectin
domestic guinea pig(100718519) osteosarcoma amplified 9, endoplasmic reticulum lectin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006812 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017956 Rosetta Predictions human pricing
NM_001017957 Rosetta Predictions human pricing
NM_001017958 Rosetta Predictions human pricing
NM_006812 Rosetta Predictions human pricing
NM_001007265 Rosetta Predictions rat pricing
NM_177614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097558 predicted 293
2 SASI_Hs01_00097559 predicted 968
3 SASI_Hs01_00097560 predicted 348
4 SASI_Hs01_00097561 predicted 316
5 SASI_Hs01_00097562 predicted 2101
6 SASI_Hs01_00097563 predicted 548
7 SASI_Hs01_00097564 predicted 2102
8 SASI_Hs01_00097565 predicted 451
9 SASI_Hs01_00097566 predicted 486
10 SASI_Hs01_00097567 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234121 predicted 287
2 SASI_Hs01_00234122 predicted 962
3 SASI_Hs01_00234123 predicted 350
4 SASI_Hs01_00234124 predicted 322
5 SASI_Hs01_00234125 predicted 2052
6 SASI_Hs01_00234126 predicted 549
7 SASI_Hs01_00234127 predicted 2050
8 SASI_Hs01_00234128 predicted 454
9 SASI_Hs01_00234129 predicted 486
10 SASI_Hs01_00234130 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177249 predicted 288
2 SASI_Hs01_00177250 predicted 970
3 SASI_Hs01_00177251 predicted 352
4 SASI_Hs01_00177252 predicted 321
5 SASI_Hs01_00177253 predicted 2220
6 SASI_Hs01_00177254 predicted 549
7 SASI_Hs01_00177255 predicted 2221
8 SASI_Hs01_00177256 predicted 454
9 SASI_Hs01_00177257 predicted 487
10 SASI_Hs01_00177258 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190946 predicted 293
2 SASI_Hs01_00190947 predicted 970
3 SASI_Hs01_00190948 predicted 354
4 SASI_Hs01_00190949 predicted 319
5 SASI_Hs01_00190950 predicted 2264
6 SASI_Hs01_00190951 predicted 549
7 SASI_Hs01_00190952 predicted 2264
8 SASI_Hs01_00190953 predicted 454
9 SASI_Hs01_00190954 predicted 487
10 SASI_Hs01_00190955 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032104 predicted 1853
2 SASI_Rn01_00032105 predicted 479
3 SASI_Rn01_00032106 predicted 477
4 SASI_Rn01_00032107 predicted 398
5 SASI_Rn01_00032108 predicted 2043
6 SASI_Rn01_00032109 predicted 407
7 SASI_Rn01_00032110 predicted 400
8 SASI_Rn02_00198649 predicted 1857
9 SASI_Rn01_00032112 predicted 210
10 SASI_Rn01_00032113 predicted 929
11 SASI_Rn01_00032111 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105333 predicted 758
2 SASI_Mm01_00105334 predicted 1836
3 SASI_Mm01_00105335 predicted 238
4 SASI_Mm01_00105336 predicted 1678
5 SASI_Mm01_00105337 predicted 383
6 SASI_Mm01_00105338 predicted 299
7 SASI_Mm01_00105339 predicted 1699
8 SASI_Mm01_00105340 predicted 294
9 SASI_Mm01_00105341 predicted 1873
10 SASI_Mm01_00105342 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177614
VALIDATED
OS9 MISSION shRNA Bacterial Glycerol Stock
osteosarcoma amplified 9, endoplasmic reticulum lectin
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-242s21c1
Sequence:CCGGGCTATTCACTTCCAACGTGAACTCGAGTTCACGTTGGAAGTGAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177614.2-1033s21c1
Sequence:CCGGTCCAAGCCCTCCCAATGATTTCTCGAGAAATCATTGGGAGGGCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-2229s21c1
Sequence:CCGGTCCATTCCCTGTTGCTGTTTGCTCGAGCAAACAGCAACAGGGAATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-201s1c1
Sequence:CCGGCAAAGTACAAACAGCGCTATGCTCGAGCATAGCGCTGTTTGTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-620s21c1
Sequence:CCGGGACTACATTGACCGAGTAGATCTCGAGATCTACTCGGTCAATGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177614.2-383s21c1
Sequence:CCGGCGTCATATCCAGCAGTACCATCTCGAGATGGTACTGCTGGATATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-1694s1c1
Sequence:CCGGGAGGATACAAGAAACCTTAAGCTCGAGCTTAAGGTTTCTTGTATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-242s1c1
Sequence:CCGGGCTATTCACTTCCAACGTGAACTCGAGTTCACGTTGGAAGTGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-1055s1c1
Sequence:CCGGCAGAATAACGTGCAGGTGAAACTCGAGTTTCACCTGCACGTTATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-383s1c1
Sequence:CCGGCGTCATATCCAGCAGTACCATCTCGAGATGGTACTGCTGGATATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-1745s1c1
Sequence:CCGGGCCGAAGAGGCCAATAAAGAACTCGAGTTCTTTATTGGCCTCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-620s1c1
Sequence:CCGGGACTACATTGACCGAGTAGATCTCGAGATCTACTCGGTCAATGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177614
VALIDATED
OS9 MISSION shRNA shRNA Plasmid DNA
osteosarcoma amplified 9, endoplasmic reticulum lectin
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-242s21c1
Sequence:CCGGGCTATTCACTTCCAACGTGAACTCGAGTTCACGTTGGAAGTGAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177614.2-1033s21c1
Sequence:CCGGTCCAAGCCCTCCCAATGATTTCTCGAGAAATCATTGGGAGGGCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-2229s21c1
Sequence:CCGGTCCATTCCCTGTTGCTGTTTGCTCGAGCAAACAGCAACAGGGAATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-201s1c1
Sequence:CCGGCAAAGTACAAACAGCGCTATGCTCGAGCATAGCGCTGTTTGTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-620s21c1
Sequence:CCGGGACTACATTGACCGAGTAGATCTCGAGATCTACTCGGTCAATGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177614.2-383s21c1
Sequence:CCGGCGTCATATCCAGCAGTACCATCTCGAGATGGTACTGCTGGATATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-1694s1c1
Sequence:CCGGGAGGATACAAGAAACCTTAAGCTCGAGCTTAAGGTTTCTTGTATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-242s1c1
Sequence:CCGGGCTATTCACTTCCAACGTGAACTCGAGTTCACGTTGGAAGTGAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-1055s1c1
Sequence:CCGGCAGAATAACGTGCAGGTGAAACTCGAGTTTCACCTGCACGTTATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-383s1c1
Sequence:CCGGCGTCATATCCAGCAGTACCATCTCGAGATGGTACTGCTGGATATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-1745s1c1
Sequence:CCGGGCCGAAGAGGCCAATAAAGAACTCGAGTTCTTTATTGGCCTCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-620s1c1
Sequence:CCGGGACTACATTGACCGAGTAGATCTCGAGATCTACTCGGTCAATGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177614
VALIDATED
OS9 MISSION shRNA Lentiviral Transduction Particles
osteosarcoma amplified 9, endoplasmic reticulum lectin
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-242s21c1
Sequence:CCGGGCTATTCACTTCCAACGTGAACTCGAGTTCACGTTGGAAGTGAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177614.2-1033s21c1
Sequence:CCGGTCCAAGCCCTCCCAATGATTTCTCGAGAAATCATTGGGAGGGCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-2229s21c1
Sequence:CCGGTCCATTCCCTGTTGCTGTTTGCTCGAGCAAACAGCAACAGGGAATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-201s1c1
Sequence:CCGGCAAAGTACAAACAGCGCTATGCTCGAGCATAGCGCTGTTTGTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177614.2-620s21c1
Sequence:CCGGGACTACATTGACCGAGTAGATCTCGAGATCTACTCGGTCAATGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177614.2-383s21c1
Sequence:CCGGCGTCATATCCAGCAGTACCATCTCGAGATGGTACTGCTGGATATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-1694s1c1
Sequence:CCGGGAGGATACAAGAAACCTTAAGCTCGAGCTTAAGGTTTCTTGTATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-242s1c1
Sequence:CCGGGCTATTCACTTCCAACGTGAACTCGAGTTCACGTTGGAAGTGAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-1055s1c1
Sequence:CCGGCAGAATAACGTGCAGGTGAAACTCGAGTTTCACCTGCACGTTATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-383s1c1
Sequence:CCGGCGTCATATCCAGCAGTACCATCTCGAGATGGTACTGCTGGATATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177614.2-1745s1c1
Sequence:CCGGGCCGAAGAGGCCAATAAAGAACTCGAGTTCTTTATTGGCCTCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177614.2-620s1c1
Sequence:CCGGGACTACATTGACCGAGTAGATCTCGAGATCTACTCGGTCAATGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006812
VALIDATED
OS9 MISSION shRNA Bacterial Glycerol Stock
osteosarcoma amplified 9, endoplasmic reticulum lectin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-1168s1c1
Sequence:CCGGCCCTGCGGATTTGATTCGATTCTCGAGAATCGAATCAAATCCGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006812.1-320s1c1
Sequence:CCGGGCTATTCACTTCCAGCGTGAACTCGAGTTCACGCTGGAAGTGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-577s1c1
Sequence:CCGGGCATCGTCTTAAACGCTACCACTCGAGTGGTAGCGTTTAAGACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-262s1c1
Sequence:CCGGCGTGGTGATTGTCTCCTCTAACTCGAGTTAGAGGAGACAATCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-199s1c1
Sequence:CCGGGATGCGTTATGGGATCGAGATCTCGAGATCTCGATCCCATAACGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-2003s1c1
Sequence:CCGGCAGAAAGAGCTGGAGAGCAATCTCGAGATTGCTCTCCAGCTCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006812.1-470s1c1
Sequence:CCGGCAGCAATACCACATGGAAGATCTCGAGATCTTCCATGTGGTATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-1172s1c1
Sequence:CCGGGCGGATTTGATTCGATTCATACTCGAGTATGAATCGAATCAAATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-478s1c1
Sequence:CCGGCCACATGGAAGATTCAGAGATCTCGAGATCTCTGAATCTTCCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-1343s1c1
Sequence:CCGGGATGAGGATGAGGATGAAGATCTCGAGATCTTCATCCTCATCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-995s1c1
Sequence:CCGGGATGACAGTAAGGACTCAGATCTCGAGATCTGAGTCCTTACTGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006812
VALIDATED
OS9 MISSION shRNA shRNA Plasmid DNA
osteosarcoma amplified 9, endoplasmic reticulum lectin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-1168s1c1
Sequence:CCGGCCCTGCGGATTTGATTCGATTCTCGAGAATCGAATCAAATCCGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006812.1-320s1c1
Sequence:CCGGGCTATTCACTTCCAGCGTGAACTCGAGTTCACGCTGGAAGTGAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-577s1c1
Sequence:CCGGGCATCGTCTTAAACGCTACCACTCGAGTGGTAGCGTTTAAGACGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-262s1c1
Sequence:CCGGCGTGGTGATTGTCTCCTCTAACTCGAGTTAGAGGAGACAATCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-199s1c1
Sequence:CCGGGATGCGTTATGGGATCGAGATCTCGAGATCTCGATCCCATAACGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-2003s1c1
Sequence:CCGGCAGAAAGAGCTGGAGAGCAATCTCGAGATTGCTCTCCAGCTCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006812.1-470s1c1
Sequence:CCGGCAGCAATACCACATGGAAGATCTCGAGATCTTCCATGTGGTATTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-1172s1c1
Sequence:CCGGGCGGATTTGATTCGATTCATACTCGAGTATGAATCGAATCAAATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-478s1c1
Sequence:CCGGCCACATGGAAGATTCAGAGATCTCGAGATCTCTGAATCTTCCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-1343s1c1
Sequence:CCGGGATGAGGATGAGGATGAAGATCTCGAGATCTTCATCCTCATCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-995s1c1
Sequence:CCGGGATGACAGTAAGGACTCAGATCTCGAGATCTGAGTCCTTACTGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006812
VALIDATED
OS9 MISSION shRNA Lentiviral Transduction Particles
osteosarcoma amplified 9, endoplasmic reticulum lectin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-1168s1c1
Sequence:CCGGCCCTGCGGATTTGATTCGATTCTCGAGAATCGAATCAAATCCGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006812.1-320s1c1
Sequence:CCGGGCTATTCACTTCCAGCGTGAACTCGAGTTCACGCTGGAAGTGAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-577s1c1
Sequence:CCGGGCATCGTCTTAAACGCTACCACTCGAGTGGTAGCGTTTAAGACGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-262s1c1
Sequence:CCGGCGTGGTGATTGTCTCCTCTAACTCGAGTTAGAGGAGACAATCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-199s1c1
Sequence:CCGGGATGCGTTATGGGATCGAGATCTCGAGATCTCGATCCCATAACGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-2003s1c1
Sequence:CCGGCAGAAAGAGCTGGAGAGCAATCTCGAGATTGCTCTCCAGCTCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006812.1-470s1c1
Sequence:CCGGCAGCAATACCACATGGAAGATCTCGAGATCTTCCATGTGGTATTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-1172s1c1
Sequence:CCGGGCGGATTTGATTCGATTCATACTCGAGTATGAATCGAATCAAATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006812.1-478s1c1
Sequence:CCGGCCACATGGAAGATTCAGAGATCTCGAGATCTCTGAATCTTCCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-1343s1c1
Sequence:CCGGGATGAGGATGAGGATGAAGATCTCGAGATCTTCATCCTCATCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006812.1-995s1c1
Sequence:CCGGGATGACAGTAAGGACTCAGATCTCGAGATCTGAGTCCTTACTGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)