EMAIL THIS PAGE TO A FRIEND

OSBPL10

oxysterol binding protein-like 10

87 Gene Product Result for
Synonyms: ORP10 OSBP9
UniProtKB ID: Q9BXB5, B4E212, Q9BTU5
Gene ID:
Human(114884) Summary: This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(74486) oxysterol binding protein-like 10
Rat(316039) oxysterol binding protein-like 10
Zebrafish(100319820) oxysterol binding protein-like 10
dog(485627) oxysterol binding protein-like 10
domestic cat(101091968) oxysterol binding protein-like 10
cow(507708) oxysterol binding protein-like 10
Horse(100057205) oxysterol binding protein-like 10
chicken(420663) oxysterol binding protein-like 10
domestic guinea pig(100735431) oxysterol binding protein-like 10
naked mole-rat(101706539) oxysterol binding protein-like 10
Domestic Rabbit(100345516) oxysterol binding protein-like 10
sheep(101111399) oxysterol binding protein-like 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017784 Rosetta Predictions human pricing
XM_001076888 Rosetta Predictions rat pricing
XM_243980 Rosetta Predictions rat pricing
NM_148958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350639 predicted 1577
2 SASI_Hs01_00210189 predicted 2726
3 SASI_Hs02_00350640 predicted 1591
4 SASI_Hs01_00210192 predicted 753
5 SASI_Hs01_00210193 predicted 800
6 SASI_Hs02_00350641 predicted 1252
7 SASI_Hs01_00210194 predicted 2360
8 SASI_Hs01_00210195 predicted 1537
9 SASI_Hs01_00210197 predicted 851
10 SASI_Hs02_00350642 predicted 1561
11 SASI_Hs01_00210190 predicted 2428
12 SASI_Hs01_00210191 predicted 1381
13 SASI_Hs01_00210196 predicted 1479
14 SASI_Hs01_00210198 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354924 predicted 917
2 SASI_Rn02_00354925 predicted 935
3 SASI_Rn02_00354926 predicted 764
4 SASI_Rn02_00354927 predicted 2100
5 SASI_Rn02_00354928 predicted 2070
6 SASI_Rn02_00354929 predicted 1095
7 SASI_Rn02_00354930 predicted 2093
8 SASI_Rn02_00354931 predicted 428
9 SASI_Rn02_00354932 predicted 1303
10 SASI_Rn02_00354933 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391799 predicted 1241
2 SASI_Rn02_00391800 predicted 1262
3 SASI_Rn02_00391801 predicted 1082
4 SASI_Rn02_00391802 predicted 2426
5 SASI_Rn02_00391803 predicted 2395
6 SASI_Rn02_00391804 predicted 1417
7 SASI_Rn02_00391805 predicted 2414
8 SASI_Rn02_00391806 predicted 331
9 SASI_Rn02_00391807 predicted 745
10 SASI_Rn02_00391808 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095609 predicted 1511
2 SASI_Mm02_00342782 predicted 795
3 SASI_Mm01_00095611 predicted 1402
4 SASI_Mm01_00095612 predicted 1443
5 SASI_Mm01_00095613 predicted 1451
6 SASI_Mm02_00342783 predicted 873
7 SASI_Mm01_00095615 predicted 1539
8 SASI_Mm01_00095617 predicted 534
9 SASI_Mm01_00095618 predicted 538
10 SASI_Mm02_00342784 predicted 311
11 SASI_Mm01_00095610 predicted 481
12 SASI_Mm01_00095614 predicted 884
13 SASI_Mm01_00095616 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148958
OSBPL10 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-635s1c1
Sequence:CCGGCGAAGAAGAACAGAGCGACAACTCGAGTTGTCGCTCTGTTCTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-193s1c1
Sequence:CCGGGAAGAGCCAAGAGTCAGTATTCTCGAGAATACTGACTCTTGGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148958.2-1814s21c1
Sequence:CCGGGGTGCAGTGCTTCCCGTAATACTCGAGTATTACGGGAAGCACTGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148958.2-798s21c1
Sequence:CCGGGAGATGTACGCAGACTTTATGCTCGAGCATAAAGTCTGCGTACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-1432s1c1
Sequence:CCGGCTGAAGTGAAACACAACCCAACTCGAGTTGGGTTGTGTTTCACTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-873s1c1
Sequence:CCGGGTCATTAGCTTCGTGGAGTATCTCGAGATACTCCACGAAGCTAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-1550s1c1
Sequence:CCGGGCCTGTGTATCCTAAGAAGCTCTCGAGAGCTTCTTAGGATACACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148958
OSBPL10 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-635s1c1
Sequence:CCGGCGAAGAAGAACAGAGCGACAACTCGAGTTGTCGCTCTGTTCTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-193s1c1
Sequence:CCGGGAAGAGCCAAGAGTCAGTATTCTCGAGAATACTGACTCTTGGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148958.2-1814s21c1
Sequence:CCGGGGTGCAGTGCTTCCCGTAATACTCGAGTATTACGGGAAGCACTGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148958.2-798s21c1
Sequence:CCGGGAGATGTACGCAGACTTTATGCTCGAGCATAAAGTCTGCGTACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-1432s1c1
Sequence:CCGGCTGAAGTGAAACACAACCCAACTCGAGTTGGGTTGTGTTTCACTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-873s1c1
Sequence:CCGGGTCATTAGCTTCGTGGAGTATCTCGAGATACTCCACGAAGCTAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-1550s1c1
Sequence:CCGGGCCTGTGTATCCTAAGAAGCTCTCGAGAGCTTCTTAGGATACACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148958
OSBPL10 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-635s1c1
Sequence:CCGGCGAAGAAGAACAGAGCGACAACTCGAGTTGTCGCTCTGTTCTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-193s1c1
Sequence:CCGGGAAGAGCCAAGAGTCAGTATTCTCGAGAATACTGACTCTTGGCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148958.2-1814s21c1
Sequence:CCGGGGTGCAGTGCTTCCCGTAATACTCGAGTATTACGGGAAGCACTGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148958.2-798s21c1
Sequence:CCGGGAGATGTACGCAGACTTTATGCTCGAGCATAAAGTCTGCGTACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-1432s1c1
Sequence:CCGGCTGAAGTGAAACACAACCCAACTCGAGTTGGGTTGTGTTTCACTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-873s1c1
Sequence:CCGGGTCATTAGCTTCGTGGAGTATCTCGAGATACTCCACGAAGCTAATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148958.1-1550s1c1
Sequence:CCGGGCCTGTGTATCCTAAGAAGCTCTCGAGAGCTTCTTAGGATACACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017784
VALIDATED
OSBPL10 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-1744s21c1
Sequence:CCGGGTCATTTGCTTCGTTGAGTATCTCGAGATACTCAACGAAGCAAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-3230s1c1
Sequence:CCGGCCCAAGAAAGATAAGCAAGTACTCGAGTACTTGCTTATCTTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-1531s21c1
Sequence:CCGGGATAAGGAAGAGACGGAATTGCTCGAGCAATTCCGTCTCTTCCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017784.3-1409s1c1
Sequence:CCGGCCAACATAACCTGGGCAATTTCTCGAGAAATTGCCCAGGTTATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-1744s1c1
Sequence:CCGGGTCATTTGCTTCGTTGAGTATCTCGAGATACTCAACGAAGCAAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-3688s1c1
Sequence:CCGGGCCTTTACACATGAGGTCAAACTCGAGTTTGACCTCATGTGTAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-2247s1c1
Sequence:CCGGGACAGTGATATTCCACACGAACTCGAGTTCGTGTGGAATATCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-2247s21c1
Sequence:CCGGGACAGTGATATTCCACACGAACTCGAGTTCGTGTGGAATATCACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-3230s21c1
Sequence:CCGGCCCAAGAAAGATAAGCAAGTACTCGAGTACTTGCTTATCTTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017784.3-1822s21c1
Sequence:CCGGCCCATCATAGGCGAGACATTTCTCGAGAAATGTCTCGCCTATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017784
VALIDATED
OSBPL10 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-1744s21c1
Sequence:CCGGGTCATTTGCTTCGTTGAGTATCTCGAGATACTCAACGAAGCAAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-3230s1c1
Sequence:CCGGCCCAAGAAAGATAAGCAAGTACTCGAGTACTTGCTTATCTTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-1531s21c1
Sequence:CCGGGATAAGGAAGAGACGGAATTGCTCGAGCAATTCCGTCTCTTCCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017784.3-1409s1c1
Sequence:CCGGCCAACATAACCTGGGCAATTTCTCGAGAAATTGCCCAGGTTATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-1744s1c1
Sequence:CCGGGTCATTTGCTTCGTTGAGTATCTCGAGATACTCAACGAAGCAAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-3688s1c1
Sequence:CCGGGCCTTTACACATGAGGTCAAACTCGAGTTTGACCTCATGTGTAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-2247s1c1
Sequence:CCGGGACAGTGATATTCCACACGAACTCGAGTTCGTGTGGAATATCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-2247s21c1
Sequence:CCGGGACAGTGATATTCCACACGAACTCGAGTTCGTGTGGAATATCACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-3230s21c1
Sequence:CCGGCCCAAGAAAGATAAGCAAGTACTCGAGTACTTGCTTATCTTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017784.3-1822s21c1
Sequence:CCGGCCCATCATAGGCGAGACATTTCTCGAGAAATGTCTCGCCTATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017784
VALIDATED
OSBPL10 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-1744s21c1
Sequence:CCGGGTCATTTGCTTCGTTGAGTATCTCGAGATACTCAACGAAGCAAATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-3230s1c1
Sequence:CCGGCCCAAGAAAGATAAGCAAGTACTCGAGTACTTGCTTATCTTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-1531s21c1
Sequence:CCGGGATAAGGAAGAGACGGAATTGCTCGAGCAATTCCGTCTCTTCCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017784.3-1409s1c1
Sequence:CCGGCCAACATAACCTGGGCAATTTCTCGAGAAATTGCCCAGGTTATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-1744s1c1
Sequence:CCGGGTCATTTGCTTCGTTGAGTATCTCGAGATACTCAACGAAGCAAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-3688s1c1
Sequence:CCGGGCCTTTACACATGAGGTCAAACTCGAGTTTGACCTCATGTGTAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_017784.3-2247s1c1
Sequence:CCGGGACAGTGATATTCCACACGAACTCGAGTTCGTGTGGAATATCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-2247s21c1
Sequence:CCGGGACAGTGATATTCCACACGAACTCGAGTTCGTGTGGAATATCACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_017784.3-3230s21c1
Sequence:CCGGCCCAAGAAAGATAAGCAAGTACTCGAGTACTTGCTTATCTTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017784.3-1822s21c1
Sequence:CCGGCCCATCATAGGCGAGACATTTCTCGAGAAATGTCTCGCCTATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)